Incidental Mutation 'R8282:Adcy10'
ID 638231
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Name adenylate cyclase 10
Synonyms sAC, Sacy, soluble adenylyl cyclase
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock # R8282 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 165485183-165576774 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 165510337 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 173 (D173E)
Ref Sequence ENSEMBL: ENSMUSP00000027852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
AlphaFold Q8C0T9
Predicted Effect probably benign
Transcript: ENSMUST00000027852
AA Change: D173E

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: D173E

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000111439
AA Change: D173E

PolyPhen 2 Score 0.583 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: D173E

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000111440
AA Change: D173E

PolyPhen 2 Score 0.583 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: D173E

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148550
AA Change: D173E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: D173E

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6330408A02Rik T C 7: 13,261,610 M207V probably benign Het
Ahctf1 T C 1: 179,777,806 D721G possibly damaging Het
Allc T C 12: 28,557,357 T299A probably damaging Het
Ankrd55 T A 13: 112,323,041 probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
Brf2 G T 8: 27,124,593 R30S Het
Bsn A G 9: 108,107,691 S283P possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces1d A T 8: 93,186,112 S233T possibly damaging Het
Chst15 T A 7: 132,270,150 H134L probably benign Het
Col14a1 A G 15: 55,420,880 T846A unknown Het
Cwh43 A T 5: 73,434,229 D555V probably damaging Het
Cyld C A 8: 88,705,415 P14T probably benign Het
Dctn1 G A 6: 83,199,756 R1264H possibly damaging Het
Dkk3 T A 7: 112,118,282 S327C probably damaging Het
Dnmbp T G 19: 43,890,566 H22P unknown Het
Fabp4 T A 3: 10,205,282 T103S probably benign Het
Fam129b A G 2: 32,919,017 E205G probably benign Het
Fam43a T C 16: 30,601,288 L230P probably damaging Het
Fam46c A G 3: 100,473,011 V143A probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fank1 T A 7: 133,876,764 Y186N probably damaging Het
Fbxo8 G A 8: 56,591,520 R286K possibly damaging Het
Fmnl2 G A 2: 53,107,666 probably null Het
Gli2 T A 1: 118,837,971 S817C probably damaging Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm13212 A T 4: 145,622,977 D328V possibly damaging Het
Gm4981 T G 10: 58,236,326 Q22P possibly damaging Het
Gstt2 C G 10: 75,832,457 A155P probably benign Het
Ints9 T A 14: 65,007,308 M213K probably benign Het
Jak1 G A 4: 101,179,541 R301* probably null Het
Kdsr T C 1: 106,724,997 T302A probably benign Het
Khsrp T C 17: 57,024,123 E460G probably damaging Het
Larp1b G A 3: 41,036,810 R193H probably damaging Het
Nedd4l A G 18: 65,191,489 K487R probably damaging Het
Nwd1 T A 8: 72,704,952 S1193T probably damaging Het
Olfr1122 A T 2: 87,388,508 T268S probably benign Het
Olfr195 T A 16: 59,149,166 C105* probably null Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Padi1 T C 4: 140,814,703 H636R probably damaging Het
Pdilt A G 7: 119,498,070 I266T probably damaging Het
Rell2 A T 18: 37,957,612 Q114L probably benign Het
Rfc1 A G 5: 65,268,946 probably null Het
Rpia T C 6: 70,771,018 N265D possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGCGGCGG 7: 97,579,920 probably null Het
Samd12 T C 15: 53,860,249 D16G probably damaging Het
Slc25a54 T C 3: 109,098,689 probably null Het
Slc6a3 T A 13: 73,557,081 D230E probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Synpo2l A G 14: 20,661,136 V472A probably benign Het
Taf6l A G 19: 8,773,350 I120T possibly damaging Het
Trappc11 T C 8: 47,516,589 D328G probably damaging Het
Trp53bp1 A G 2: 121,199,042 S1836P probably damaging Het
Ugt2b37 G A 5: 87,254,581 L64F probably benign Het
Vmn2r56 A T 7: 12,715,674 Y212* probably null Het
Vps54 T A 11: 21,300,464 probably benign Het
Zfp648 T A 1: 154,204,789 H231Q probably benign Het
Zscan4d T A 7: 11,162,442 T334S possibly damaging Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165551914 missense probably benign 0.45
IGL00731:Adcy10 APN 1 165572614 missense probably benign
IGL01099:Adcy10 APN 1 165539842 missense probably benign 0.21
IGL01464:Adcy10 APN 1 165546587 missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165513168 critical splice donor site probably null
IGL02002:Adcy10 APN 1 165521843 missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165570620 missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165572543 missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165559128 missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165538380 missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165510408 missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165570744 missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165567726 missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165543233 missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165519518 missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165538475 nonsense probably null
Bugged UTSW 1 165564237 missense probably damaging 0.99
debye UTSW 1 165551361 critical splice donor site probably null
malaysian UTSW 1 165513127 missense probably benign 0.38
singaporean UTSW 1 165518312 missense probably damaging 0.98
PIT4514001:Adcy10 UTSW 1 165556791 missense probably benign 0.28
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165539834 missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165572591 missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165564249 missense probably benign 0.00
R0433:Adcy10 UTSW 1 165552022 missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165570728 missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165510390 missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165519519 missense probably benign 0.04
R0533:Adcy10 UTSW 1 165564023 missense probably benign 0.05
R0550:Adcy10 UTSW 1 165565315 missense probably benign 0.00
R0554:Adcy10 UTSW 1 165513130 missense probably benign
R0597:Adcy10 UTSW 1 165525062 critical splice donor site probably null
R0629:Adcy10 UTSW 1 165543105 missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165563947 missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165515380 missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165518403 missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165518312 missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165525033 missense probably benign 0.02
R1690:Adcy10 UTSW 1 165519925 missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165503243 missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165521961 missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165570808 missense probably benign 0.02
R1929:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165525022 missense probably benign 0.02
R2211:Adcy10 UTSW 1 165518212 missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165518260 missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165510297 missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165558597 missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165575727 missense probably benign 0.38
R4538:Adcy10 UTSW 1 165513127 missense probably benign 0.38
R4644:Adcy10 UTSW 1 165551361 critical splice donor site probably null
R4649:Adcy10 UTSW 1 165504049 missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165506644 missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165548213 missense probably benign
R4916:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165563963 missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165556862 missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165519500 missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165519895 missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165513140 missense probably benign 0.43
R5692:Adcy10 UTSW 1 165515306 missense probably benign 0.36
R5949:Adcy10 UTSW 1 165539817 missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165541649 missense probably benign 0.19
R6238:Adcy10 UTSW 1 165575728 nonsense probably null
R6455:Adcy10 UTSW 1 165518374 missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165575658 missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165506635 missense probably benign 0.21
R6957:Adcy10 UTSW 1 165564285 missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165556916 missense probably benign 0.02
R7027:Adcy10 UTSW 1 165518246 missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165539874 missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165538522 missense probably benign 0.27
R7130:Adcy10 UTSW 1 165504047 missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165510370 missense probably benign 0.01
R7182:Adcy10 UTSW 1 165543470 splice site probably null
R7228:Adcy10 UTSW 1 165510272 missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165576608 missense unknown
R7561:Adcy10 UTSW 1 165559172 missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165564237 missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165570771 missense probably benign 0.01
R7812:Adcy10 UTSW 1 165515369 missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165513168 critical splice donor site probably null
R8040:Adcy10 UTSW 1 165552024 missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165546549 missense possibly damaging 0.82
R8278:Adcy10 UTSW 1 165503288 missense probably damaging 1.00
R8812:Adcy10 UTSW 1 165551298 missense probably damaging 0.98
R9039:Adcy10 UTSW 1 165518345 missense probably damaging 1.00
R9178:Adcy10 UTSW 1 165575649 missense possibly damaging 0.79
R9244:Adcy10 UTSW 1 165543110 missense probably benign 0.00
R9712:Adcy10 UTSW 1 165513112 missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165552109 missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165510276 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCGTAGAGGCGTTTCTGATTTC -3'
(R):5'- TAGGCTAACCCTGACTCTGGAG -3'

Sequencing Primer
(F):5'- GCTTAGAGGTTGTGTAGCCAC -3'
(R):5'- TCATGCTCCGATCACAGA -3'
Posted On 2020-07-28