Incidental Mutation 'R8282:Fam46c'
ID638239
Institutional Source Beutler Lab
Gene Symbol Fam46c
Ensembl Gene ENSMUSG00000044468
Gene Namefamily with sequence similarity 46, member C
Synonyms4930431B09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8282 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location100451628-100489324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100473011 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 143 (V143A)
Ref Sequence ENSEMBL: ENSMUSP00000056872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061455]
Predicted Effect probably damaging
Transcript: ENSMUST00000061455
AA Change: V143A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056872
Gene: ENSMUSG00000044468
AA Change: V143A

DomainStartEndE-ValueType
DUF1693 17 336 3.33e-241 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypochromic microcytic anemia and decreased B cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6330408A02Rik T C 7: 13,261,610 M207V probably benign Het
Adcy10 T A 1: 165,510,337 D173E probably benign Het
Ahctf1 T C 1: 179,777,806 D721G possibly damaging Het
Allc T C 12: 28,557,357 T299A probably damaging Het
Ankrd55 T A 13: 112,323,041 probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
Brf2 G T 8: 27,124,593 R30S Het
Bsn A G 9: 108,107,691 S283P possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces1d A T 8: 93,186,112 S233T possibly damaging Het
Chst15 T A 7: 132,270,150 H134L probably benign Het
Col14a1 A G 15: 55,420,880 T846A unknown Het
Cwh43 A T 5: 73,434,229 D555V probably damaging Het
Cyld C A 8: 88,705,415 P14T probably benign Het
Dctn1 G A 6: 83,199,756 R1264H possibly damaging Het
Dkk3 T A 7: 112,118,282 S327C probably damaging Het
Dnmbp T G 19: 43,890,566 H22P unknown Het
Fabp4 T A 3: 10,205,282 T103S probably benign Het
Fam129b A G 2: 32,919,017 E205G probably benign Het
Fam43a T C 16: 30,601,288 L230P probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fank1 T A 7: 133,876,764 Y186N probably damaging Het
Fbxo8 G A 8: 56,591,520 R286K possibly damaging Het
Fmnl2 G A 2: 53,107,666 probably null Het
Gli2 T A 1: 118,837,971 S817C probably damaging Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm13212 A T 4: 145,622,977 D328V possibly damaging Het
Gm4981 T G 10: 58,236,326 Q22P possibly damaging Het
Gstt2 C G 10: 75,832,457 A155P probably benign Het
Ints9 T A 14: 65,007,308 M213K probably benign Het
Jak1 G A 4: 101,179,541 R301* probably null Het
Kdsr T C 1: 106,724,997 T302A probably benign Het
Khsrp T C 17: 57,024,123 E460G probably damaging Het
Larp1b G A 3: 41,036,810 R193H probably damaging Het
Nedd4l A G 18: 65,191,489 K487R probably damaging Het
Nwd1 T A 8: 72,704,952 S1193T probably damaging Het
Olfr1122 A T 2: 87,388,508 T268S probably benign Het
Olfr195 T A 16: 59,149,166 C105* probably null Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Padi1 T C 4: 140,814,703 H636R probably damaging Het
Pdilt A G 7: 119,498,070 I266T probably damaging Het
Rell2 A T 18: 37,957,612 Q114L probably benign Het
Rfc1 A G 5: 65,268,946 probably null Het
Rpia T C 6: 70,771,018 N265D possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGCGGCGG 7: 97,579,920 probably null Het
Samd12 T C 15: 53,860,249 D16G probably damaging Het
Slc25a54 T C 3: 109,098,689 probably null Het
Slc6a3 T A 13: 73,557,081 D230E probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Synpo2l A G 14: 20,661,136 V472A probably benign Het
Taf6l A G 19: 8,773,350 I120T possibly damaging Het
Trappc11 T C 8: 47,516,589 D328G probably damaging Het
Trp53bp1 A G 2: 121,199,042 S1836P probably damaging Het
Ugt2b37 G A 5: 87,254,581 L64F probably benign Het
Vmn2r56 A T 7: 12,715,674 Y212* probably null Het
Vps54 T A 11: 21,300,464 probably benign Het
Zfp648 T A 1: 154,204,789 H231Q probably benign Het
Zscan4d T A 7: 11,162,442 T334S possibly damaging Het
Other mutations in Fam46c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Fam46c APN 3 100473356 missense probably damaging 0.96
IGL01314:Fam46c APN 3 100473174 missense probably benign 0.18
IGL01409:Fam46c APN 3 100473169 missense probably damaging 1.00
IGL01817:Fam46c APN 3 100472855 missense probably damaging 1.00
IGL01863:Fam46c APN 3 100472664 missense probably benign 0.05
IGL01992:Fam46c APN 3 100472630 missense probably damaging 1.00
IGL02436:Fam46c APN 3 100472507 missense probably benign 0.43
R0111:Fam46c UTSW 3 100472786 missense probably damaging 1.00
R0529:Fam46c UTSW 3 100472370 missense probably benign 0.36
R1196:Fam46c UTSW 3 100473000 missense possibly damaging 0.73
R1242:Fam46c UTSW 3 100472876 missense probably damaging 1.00
R4671:Fam46c UTSW 3 100473199 missense probably benign 0.44
R5252:Fam46c UTSW 3 100472708 missense probably damaging 1.00
R6730:Fam46c UTSW 3 100472957 missense probably benign 0.07
R8205:Fam46c UTSW 3 100472822 missense probably benign 0.04
R8483:Fam46c UTSW 3 100472468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACTGTGGGGTGGAAATGC -3'
(R):5'- ACGTTTTGGTCAAAGACAACGG -3'

Sequencing Primer
(F):5'- CTCGGAGATGGGATTGCC -3'
(R):5'- TTTGGTCAAAGACAACGGCTTGG -3'
Posted On2020-07-28