Incidental Mutation 'R0724:Cryba1'
ID63824
Institutional Source Beutler Lab
Gene Symbol Cryba1
Ensembl Gene ENSMUSG00000000724
Gene Namecrystallin, beta A1
SynonymsCryb, BA3/A1
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0724 (G1)
Quality Score114
Status Validated
Chromosome11
Chromosomal Location77718615-77725283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77719457 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 144 (D144G)
Ref Sequence ENSEMBL: ENSMUSP00000077693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078623] [ENSMUST00000181023]
Predicted Effect probably damaging
Transcript: ENSMUST00000078623
AA Change: D144G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077693
Gene: ENSMUSG00000000724
AA Change: D144G

DomainStartEndE-ValueType
XTALbg 32 116 1.27e-43 SMART
XTALbg 125 213 3.49e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124178
Predicted Effect probably benign
Transcript: ENSMUST00000181023
SMART Domains Protein: ENSMUSP00000137922
Gene: ENSMUSG00000037857

DomainStartEndE-ValueType
low complexity region 7 61 N/A INTRINSIC
Pfam:NUFIP2 89 681 7e-293 PFAM
Meta Mutation Damage Score 0.8596 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Mammalian lens crystallins are divided into alpha, beta, and gamma families. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group, none in the acidic group). Beta-crystallins form aggregates of different sizes and are able to self-associate to form dimers or to form heterodimers with other beta-crystallins. This gene, a beta acidic group member, encodes two proteins (crystallin, beta A3 and crystallin, beta A1) from a single mRNA. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a knock-out allele exhibit microphthalmia, congenital nuclear cataracts, persistent hyaloid artery, and lens defects including impaired lysosomal cargo clearance, increased calcium level, and cytoskeletal defects. Homozygotes for an ENU allele show microphthalmia and total cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Cryba1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02964:Cryba1 APN 11 77719381 intron probably benign
R0211:Cryba1 UTSW 11 77718867 missense probably damaging 0.99
R0211:Cryba1 UTSW 11 77718867 missense probably damaging 0.99
R2357:Cryba1 UTSW 11 77722601 intron probably benign
R2416:Cryba1 UTSW 11 77720900 missense probably damaging 1.00
R6866:Cryba1 UTSW 11 77719529 missense probably benign 0.05
R7624:Cryba1 UTSW 11 77722717 missense probably damaging 1.00
R7805:Cryba1 UTSW 11 77722608 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGCGTGAGATCCCCACTCTG -3'
(R):5'- TGCTGGGACTAAACATGTACACCATAAC -3'

Sequencing Primer
(F):5'- gaggtggctctgtgagtg -3'
(R):5'- AATCCCTGTTAAGCTCAACAATG -3'
Posted On2013-07-30