Incidental Mutation 'R8282:Vmn2r56'
ID638251
Institutional Source Beutler Lab
Gene Symbol Vmn2r56
Ensembl Gene ENSMUSG00000090762
Gene Namevomeronasal 2, receptor 56
SynonymsEG629079
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R8282 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12693998-12733105 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 12715674 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 212 (Y212*)
Ref Sequence ENSEMBL: ENSMUSP00000129566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163852]
Predicted Effect probably null
Transcript: ENSMUST00000163852
AA Change: Y212*
SMART Domains Protein: ENSMUSP00000129566
Gene: ENSMUSG00000090762
AA Change: Y212*

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 1.9e-55 PFAM
Pfam:NCD3G 439 492 6.4e-20 PFAM
Pfam:7tm_3 523 760 1.3e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6330408A02Rik T C 7: 13,261,610 M207V probably benign Het
Adcy10 T A 1: 165,510,337 D173E probably benign Het
Ahctf1 T C 1: 179,777,806 D721G possibly damaging Het
Allc T C 12: 28,557,357 T299A probably damaging Het
Axl C T 7: 25,763,954 D633N probably benign Het
Brf2 G T 8: 27,124,593 R30S Het
Bsn A G 9: 108,107,691 S283P possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces1d A T 8: 93,186,112 S233T possibly damaging Het
Chst15 T A 7: 132,270,150 H134L probably benign Het
Col14a1 A G 15: 55,420,880 T846A unknown Het
Cwh43 A T 5: 73,434,229 D555V probably damaging Het
Cyld C A 8: 88,705,415 P14T probably benign Het
Dctn1 G A 6: 83,199,756 R1264H possibly damaging Het
Dkk3 T A 7: 112,118,282 S327C probably damaging Het
Dnmbp T G 19: 43,890,566 H22P unknown Het
Fabp4 T A 3: 10,205,282 T103S probably benign Het
Fam129b A G 2: 32,919,017 E205G probably benign Het
Fam43a T C 16: 30,601,288 L230P probably damaging Het
Fam46c A G 3: 100,473,011 V143A probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fank1 T A 7: 133,876,764 Y186N probably damaging Het
Fbxo8 G A 8: 56,591,520 R286K possibly damaging Het
Fmnl2 G A 2: 53,107,666 probably null Het
Gli2 T A 1: 118,837,971 S817C probably damaging Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm13212 A T 4: 145,622,977 D328V possibly damaging Het
Gm4981 T G 10: 58,236,326 Q22P possibly damaging Het
Gstt2 C G 10: 75,832,457 A155P probably benign Het
Ints9 T A 14: 65,007,308 M213K probably benign Het
Jak1 G A 4: 101,179,541 R301* probably null Het
Kdsr T C 1: 106,724,997 T302A probably benign Het
Khsrp T C 17: 57,024,123 E460G probably damaging Het
Larp1b G A 3: 41,036,810 R193H probably damaging Het
Nedd4l A G 18: 65,191,489 K487R probably damaging Het
Nwd1 T A 8: 72,704,952 S1193T probably damaging Het
Olfr1122 A T 2: 87,388,508 T268S probably benign Het
Olfr195 T A 16: 59,149,166 C105* probably null Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Padi1 T C 4: 140,814,703 H636R probably damaging Het
Pdilt A G 7: 119,498,070 I266T probably damaging Het
Rell2 A T 18: 37,957,612 Q114L probably benign Het
Rfc1 A G 5: 65,268,946 probably null Het
Rpia T C 6: 70,771,018 N265D possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGCGGCGG 7: 97,579,920 probably null Het
Samd12 T C 15: 53,860,249 D16G probably damaging Het
Slc25a54 T C 3: 109,098,689 probably null Het
Slc6a3 T A 13: 73,557,081 D230E probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Synpo2l A G 14: 20,661,136 V472A probably benign Het
Taf6l A G 19: 8,773,350 I120T possibly damaging Het
Trappc11 T C 8: 47,516,589 D328G probably damaging Het
Trp53bp1 A G 2: 121,199,042 S1836P probably damaging Het
Ugt2b37 G A 5: 87,254,581 L64F probably benign Het
Zfp648 T A 1: 154,204,789 H231Q probably benign Het
Zscan4d T A 7: 11,162,442 T334S possibly damaging Het
Other mutations in Vmn2r56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Vmn2r56 APN 7 12715499 missense probably benign 0.38
IGL01060:Vmn2r56 APN 7 12713089 missense probably damaging 0.97
IGL01433:Vmn2r56 APN 7 12715614 missense probably benign
IGL01859:Vmn2r56 APN 7 12716005 missense probably damaging 1.00
IGL01874:Vmn2r56 APN 7 12715675 missense probably benign 0.03
IGL02208:Vmn2r56 APN 7 12715481 missense probably benign 0.01
PIT4445001:Vmn2r56 UTSW 7 12715226 critical splice donor site probably null
R0077:Vmn2r56 UTSW 7 12715405 missense probably benign 0.01
R0278:Vmn2r56 UTSW 7 12715717 missense probably damaging 0.99
R0512:Vmn2r56 UTSW 7 12715423 missense probably benign
R0658:Vmn2r56 UTSW 7 12710308 missense probably benign 0.10
R0789:Vmn2r56 UTSW 7 12732835 missense probably damaging 1.00
R1534:Vmn2r56 UTSW 7 12694027 missense probably benign
R1731:Vmn2r56 UTSW 7 12733045 missense probably benign
R1817:Vmn2r56 UTSW 7 12715615 missense probably benign
R2047:Vmn2r56 UTSW 7 12732991 missense probably damaging 1.00
R2139:Vmn2r56 UTSW 7 12712963 nonsense probably null
R2160:Vmn2r56 UTSW 7 12694219 missense probably benign 0.43
R2449:Vmn2r56 UTSW 7 12694155 missense possibly damaging 0.67
R2877:Vmn2r56 UTSW 7 12711027 missense probably benign
R2878:Vmn2r56 UTSW 7 12711027 missense probably benign
R4910:Vmn2r56 UTSW 7 12715535 missense possibly damaging 0.64
R5072:Vmn2r56 UTSW 7 12694056 missense probably benign 0.40
R5340:Vmn2r56 UTSW 7 12715872 missense probably damaging 1.00
R5697:Vmn2r56 UTSW 7 12715990 missense probably damaging 1.00
R5798:Vmn2r56 UTSW 7 12712965 missense probably benign 0.00
R6166:Vmn2r56 UTSW 7 12694020 missense probably damaging 1.00
R6290:Vmn2r56 UTSW 7 12694882 missense probably damaging 1.00
R6458:Vmn2r56 UTSW 7 12694057 missense probably damaging 0.99
R6751:Vmn2r56 UTSW 7 12694792 missense probably benign
R6978:Vmn2r56 UTSW 7 12715406 missense probably benign 0.01
R7090:Vmn2r56 UTSW 7 12715327 missense probably damaging 1.00
R7200:Vmn2r56 UTSW 7 12710332 missense probably damaging 1.00
R7861:Vmn2r56 UTSW 7 12715424 missense probably benign 0.00
R8222:Vmn2r56 UTSW 7 12711033 missense probably benign
RF002:Vmn2r56 UTSW 7 12694830 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TATAAACATGTCTTCTGGGGTCTG -3'
(R):5'- TGATGACTTTGGGCAGCAGG -3'

Sequencing Primer
(F):5'- CTTCTGGGGTCTGGCTGG -3'
(R):5'- AGCAGGCCAGCTCTCTG -3'
Posted On2020-07-28