Incidental Mutation 'R0724:Tshr'
ID 63826
Institutional Source Beutler Lab
Gene Symbol Tshr
Ensembl Gene ENSMUSG00000020963
Gene Name thyroid stimulating hormone receptor
Synonyms pet, hyt, hypothroid
MMRRC Submission 038906-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.287) question?
Stock # R0724 (G1)
Quality Score 113
Status Validated
Chromosome 12
Chromosomal Location 91384563-91549808 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 91538286 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 666 (F666S)
Ref Sequence ENSEMBL: ENSMUSP00000021346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021346] [ENSMUST00000186437] [ENSMUST00000221216]
AlphaFold P47750
Predicted Effect probably damaging
Transcript: ENSMUST00000021346
AA Change: F666S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021346
Gene: ENSMUSG00000020963
AA Change: F666S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:LRR_5 53 153 9.5e-7 PFAM
Pfam:LRR_5 148 244 5.1e-5 PFAM
Pfam:7tm_1 431 678 2.6e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186437
AA Change: F74S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139632
Gene: ENSMUSG00000020963
AA Change: F74S

DomainStartEndE-ValueType
Pfam:7tm_1 1 86 6.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221216
Meta Mutation Damage Score 0.7250 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene exhibit profound hypothyroidism, developmental and growth retardation, impaired hearing with cochlear defects, and infertility. One mutation results in high postweaning mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Tshr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Tshr APN 12 91537500 missense probably damaging 1.00
IGL01503:Tshr APN 12 91511934 missense probably damaging 1.00
IGL01730:Tshr APN 12 91519303 missense possibly damaging 0.93
IGL02109:Tshr APN 12 91537992 missense probably damaging 1.00
IGL02199:Tshr APN 12 91538283 missense probably damaging 1.00
IGL02439:Tshr APN 12 91537547 missense probably damaging 0.97
IGL02696:Tshr APN 12 91493329 missense possibly damaging 0.72
IGL03170:Tshr APN 12 91537869 missense probably damaging 1.00
IGL03208:Tshr APN 12 91533942 missense probably damaging 1.00
freckle UTSW 12 91538226 nonsense probably null
R0067_Tshr_655 UTSW 12 91505283 missense probably damaging 1.00
R0017:Tshr UTSW 12 91537886 missense possibly damaging 0.95
R0017:Tshr UTSW 12 91537886 missense possibly damaging 0.95
R0067:Tshr UTSW 12 91505283 missense probably damaging 1.00
R0419:Tshr UTSW 12 91537869 missense probably damaging 1.00
R0658:Tshr UTSW 12 91538226 nonsense probably null
R1170:Tshr UTSW 12 91538097 missense probably damaging 1.00
R1188:Tshr UTSW 12 91502168 missense probably benign 0.00
R1548:Tshr UTSW 12 91534031 missense probably damaging 1.00
R1677:Tshr UTSW 12 91537341 missense possibly damaging 0.81
R1808:Tshr UTSW 12 91537316 missense probably benign 0.00
R1934:Tshr UTSW 12 91537181 missense probably damaging 0.99
R3980:Tshr UTSW 12 91537743 missense probably damaging 1.00
R4008:Tshr UTSW 12 91537494 missense probably benign 0.21
R4828:Tshr UTSW 12 91537790 missense probably damaging 1.00
R4903:Tshr UTSW 12 91401188 missense probably benign 0.09
R4958:Tshr UTSW 12 91538187 missense probably damaging 1.00
R5528:Tshr UTSW 12 91537193 missense probably damaging 1.00
R5949:Tshr UTSW 12 91537218 missense probably damaging 1.00
R6136:Tshr UTSW 12 91538234 missense probably benign 0.34
R6147:Tshr UTSW 12 91538235 missense possibly damaging 0.84
R6454:Tshr UTSW 12 91538549 missense probably benign 0.33
R6572:Tshr UTSW 12 91538360 missense probably benign 0.29
R6884:Tshr UTSW 12 91538102 missense probably damaging 1.00
R6986:Tshr UTSW 12 91533957 missense probably damaging 0.97
R7403:Tshr UTSW 12 91497774 missense probably damaging 1.00
R7691:Tshr UTSW 12 91497741 missense probably benign 0.00
R7741:Tshr UTSW 12 91533969 nonsense probably null
R7769:Tshr UTSW 12 91538270 missense probably damaging 1.00
R7784:Tshr UTSW 12 91505305 missense probably benign 0.02
R7934:Tshr UTSW 12 91511928 missense possibly damaging 0.88
R8060:Tshr UTSW 12 91538360 missense probably benign 0.12
R8168:Tshr UTSW 12 91511965 missense probably benign 0.19
R8552:Tshr UTSW 12 91537285 missense probably benign 0.00
R8762:Tshr UTSW 12 91537550 missense probably damaging 1.00
R8917:Tshr UTSW 12 91502055 intron probably benign
R8918:Tshr UTSW 12 91537437 missense probably benign 0.00
R8945:Tshr UTSW 12 91538223 missense probably damaging 1.00
R9002:Tshr UTSW 12 91537774 missense possibly damaging 0.95
R9056:Tshr UTSW 12 91507789 missense probably damaging 1.00
R9122:Tshr UTSW 12 91511963 missense probably benign 0.19
R9126:Tshr UTSW 12 91537218 missense probably damaging 1.00
R9282:Tshr UTSW 12 91507744 missense possibly damaging 0.53
R9488:Tshr UTSW 12 91537815 missense probably damaging 1.00
R9630:Tshr UTSW 12 91537635 missense probably damaging 1.00
R9632:Tshr UTSW 12 91537635 missense probably damaging 1.00
R9687:Tshr UTSW 12 91537665 missense probably damaging 1.00
Z1176:Tshr UTSW 12 91538491 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AAGGTCAGCATCTGCCTGCCAATG -3'
(R):5'- TCACTGTGACTAGCGTAGCCTTTCC -3'

Sequencing Primer
(F):5'- TGTGAAGATCTACATCACGGTCC -3'
(R):5'- GGAGTTTCCAAGCAGTTCATAG -3'
Posted On 2013-07-30