Mutagenetix > Incidental Mutation

Incidental Mutation 'R0724:Tshr'

63826

Institutional Source

Beutler Lab

Gene Symbol

Tshr

Ensembl Gene

ENSMUSG00000020963

Gene Name

thyroid stimulating hormone receptor

Synonyms

pet, hyt, hypothroid

MMRRC Submission

038906-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.287) question?

Stock #

R0724 (G1)

Quality Score

113

Status

Validated

Chromosome

Chromosomal Location

91384563-91549808 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 91538286 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 666 (F666S)

Ref Sequence

ENSEMBL: ENSMUSP00000021346 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021346] [ENSMUST00000186437] [ENSMUST00000221216]

AlphaFold

P47750

Predicted Effect

probably damaging
Transcript: ENSMUST00000021346
AA Change: F666S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021346
Gene: ENSMUSG00000020963
AA Change: F666S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:LRR_5	53	153	9.5e-7	PFAM
Pfam:LRR_5	148	244	5.1e-5	PFAM
Pfam:7tm_1	431	678	2.6e-30	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000186437
AA Change: F74S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139632
Gene: ENSMUSG00000020963
AA Change: F74S

Domain	Start	End	E-Value	Type
Pfam:7tm_1	1	86	6.4e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000221216

Meta Mutation Damage Score

0.7250

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.5%
20x: 95.2%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene exhibit profound hypothyroidism, developmental and growth retardation, impaired hearing with cochlear defects, and infertility. One mutation results in high postweaning mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018F24Rik	A	G	5: 145,044,763	E136G	probably benign	Het
Adgre4	T	A	17: 55,852,281	S655R	probably benign	Het
Ak7	T	A	12: 105,710,254	V71E	probably benign	Het
Ank2	C	T	3: 126,962,337	R1077H	probably damaging	Het
Anxa3	A	G	5: 96,828,748	T198A	possibly damaging	Het
Atp1a1	A	T	3: 101,592,439	I109N	possibly damaging	Het
Camta1	A	G	4: 151,077,892	I119T	probably damaging	Het
Carm1	A	G	9: 21,587,374	Y504C	probably damaging	Het
Casp1	C	T	9: 5,303,077	P177L	probably benign	Het
Ccdc122	C	A	14: 77,092,077		probably benign	Het
Ces1a	A	G	8: 93,039,513	S158P	probably damaging	Het
Ces3a	T	A	8: 105,050,195	D103E	possibly damaging	Het
Clstn1	A	C	4: 149,643,624	D583A	possibly damaging	Het
Corin	A	G	5: 72,332,795		probably benign	Het
Cryba1	T	C	11: 77,719,457	D144G	probably damaging	Het
Cwf19l2	G	T	9: 3,421,377		probably null	Het
Dis3l	T	C	9: 64,307,126	T1027A	possibly damaging	Het
Dopey2	A	G	16: 93,762,325	E653G	probably benign	Het
Dst	A	G	1: 34,188,677	I1459V	probably benign	Het
Dyrk3	T	C	1: 131,130,140	T64A	probably benign	Het
Emp2	C	T	16: 10,284,615	C111Y	probably benign	Het
Enam	A	G	5: 88,501,994	Y454C	probably damaging	Het
Fbn1	A	T	2: 125,352,064	C1328S	probably benign	Het
Gata3	T	C	2: 9,874,575	T197A	probably benign	Het
Gm1043	A	G	5: 37,187,229	T212A	probably damaging	Het
Gm15448	T	C	7: 3,816,872	N564S	possibly damaging	Het
H2-Eb1	T	C	17: 34,315,032		probably benign	Het
Hand1	T	C	11: 57,831,680	H36R	probably damaging	Het
Hmgcs2	C	A	3: 98,297,001	Y239*	probably null	Het
Hoxc12	A	G	15: 102,937,055	Y68C	probably damaging	Het
Inpp5a	A	G	7: 139,516,663	I143V	probably benign	Het
Klhdc2	C	A	12: 69,297,048	F18L	probably benign	Het
Kpnb1	T	C	11: 97,178,304	Y251C	probably damaging	Het
Lrch4	A	T	5: 137,637,308	N315I	probably damaging	Het
Map3k10	A	C	7: 27,668,355	V286G	probably damaging	Het
Myo7b	G	A	18: 32,005,549		probably benign	Het
Nlrp2	G	T	7: 5,319,222	L809I	probably damaging	Het
Oacyl	T	C	18: 65,737,825		probably benign	Het
Olfr735	A	G	14: 50,345,917	V175A	possibly damaging	Het
Paxbp1	T	A	16: 91,036,536	D270V	probably damaging	Het
Pdia3	G	A	2: 121,432,377	G275S	probably damaging	Het
Plcb3	G	A	19: 6,963,392	R359C	probably damaging	Het
Plcxd3	G	A	15: 4,516,868	S118N	probably damaging	Het
Ptpn14	T	C	1: 189,850,947	S664P	possibly damaging	Het
Sirt1	T	C	10: 63,323,973	I443V	possibly damaging	Het
Slc7a8	G	A	14: 54,735,186		probably benign	Het
Smim14	A	G	5: 65,453,339		probably benign	Het
Sost	C	T	11: 101,966,918	C19Y	probably benign	Het
Tcaf1	G	T	6: 42,675,367	A727E	probably damaging	Het
Thoc1	T	C	18: 9,963,829	L144P	probably damaging	Het
Tmem132b	A	T	5: 125,783,421	T577S	possibly damaging	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Wdr1	A	G	5: 38,540,862	V192A	possibly damaging	Het
Zfp697	T	C	3: 98,428,166	W416R	probably damaging	Het

Other mutations in Tshr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00647:Tshr	APN	12	91537500	missense	probably damaging	1.00
IGL01503:Tshr	APN	12	91511934	missense	probably damaging	1.00
IGL01730:Tshr	APN	12	91519303	missense	possibly damaging	0.93
IGL02109:Tshr	APN	12	91537992	missense	probably damaging	1.00
IGL02199:Tshr	APN	12	91538283	missense	probably damaging	1.00
IGL02439:Tshr	APN	12	91537547	missense	probably damaging	0.97
IGL02696:Tshr	APN	12	91493329	missense	possibly damaging	0.72
IGL03170:Tshr	APN	12	91537869	missense	probably damaging	1.00
IGL03208:Tshr	APN	12	91533942	missense	probably damaging	1.00
freckle	UTSW	12	91538226	nonsense	probably null
R0067_Tshr_655	UTSW	12	91505283	missense	probably damaging	1.00
R0017:Tshr	UTSW	12	91537886	missense	possibly damaging	0.95
R0017:Tshr	UTSW	12	91537886	missense	possibly damaging	0.95
R0067:Tshr	UTSW	12	91505283	missense	probably damaging	1.00
R0419:Tshr	UTSW	12	91537869	missense	probably damaging	1.00
R0658:Tshr	UTSW	12	91538226	nonsense	probably null
R1170:Tshr	UTSW	12	91538097	missense	probably damaging	1.00
R1188:Tshr	UTSW	12	91502168	missense	probably benign	0.00
R1548:Tshr	UTSW	12	91534031	missense	probably damaging	1.00
R1677:Tshr	UTSW	12	91537341	missense	possibly damaging	0.81
R1808:Tshr	UTSW	12	91537316	missense	probably benign	0.00
R1934:Tshr	UTSW	12	91537181	missense	probably damaging	0.99
R3980:Tshr	UTSW	12	91537743	missense	probably damaging	1.00
R4008:Tshr	UTSW	12	91537494	missense	probably benign	0.21
R4828:Tshr	UTSW	12	91537790	missense	probably damaging	1.00
R4903:Tshr	UTSW	12	91401188	missense	probably benign	0.09
R4958:Tshr	UTSW	12	91538187	missense	probably damaging	1.00
R5528:Tshr	UTSW	12	91537193	missense	probably damaging	1.00
R5949:Tshr	UTSW	12	91537218	missense	probably damaging	1.00
R6136:Tshr	UTSW	12	91538234	missense	probably benign	0.34
R6147:Tshr	UTSW	12	91538235	missense	possibly damaging	0.84
R6454:Tshr	UTSW	12	91538549	missense	probably benign	0.33
R6572:Tshr	UTSW	12	91538360	missense	probably benign	0.29
R6884:Tshr	UTSW	12	91538102	missense	probably damaging	1.00
R6986:Tshr	UTSW	12	91533957	missense	probably damaging	0.97
R7403:Tshr	UTSW	12	91497774	missense	probably damaging	1.00
R7691:Tshr	UTSW	12	91497741	missense	probably benign	0.00
R7741:Tshr	UTSW	12	91533969	nonsense	probably null
R7769:Tshr	UTSW	12	91538270	missense	probably damaging	1.00
R7784:Tshr	UTSW	12	91505305	missense	probably benign	0.02
R7934:Tshr	UTSW	12	91511928	missense	possibly damaging	0.88
R8060:Tshr	UTSW	12	91538360	missense	probably benign	0.12
R8168:Tshr	UTSW	12	91511965	missense	probably benign	0.19
R8552:Tshr	UTSW	12	91537285	missense	probably benign	0.00
R8762:Tshr	UTSW	12	91537550	missense	probably damaging	1.00
R8917:Tshr	UTSW	12	91502055	intron	probably benign
R8918:Tshr	UTSW	12	91537437	missense	probably benign	0.00
R8945:Tshr	UTSW	12	91538223	missense	probably damaging	1.00
R9002:Tshr	UTSW	12	91537774	missense	possibly damaging	0.95
R9056:Tshr	UTSW	12	91507789	missense	probably damaging	1.00
R9122:Tshr	UTSW	12	91511963	missense	probably benign	0.19
R9126:Tshr	UTSW	12	91537218	missense	probably damaging	1.00
R9282:Tshr	UTSW	12	91507744	missense	possibly damaging	0.53
R9488:Tshr	UTSW	12	91537815	missense	probably damaging	1.00
R9630:Tshr	UTSW	12	91537635	missense	probably damaging	1.00
R9632:Tshr	UTSW	12	91537635	missense	probably damaging	1.00
R9687:Tshr	UTSW	12	91537665	missense	probably damaging	1.00
Z1176:Tshr	UTSW	12	91538491	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- AAGGTCAGCATCTGCCTGCCAATG -3'
(R):5'- TCACTGTGACTAGCGTAGCCTTTCC -3'

Sequencing Primer
(F):5'- TGTGAAGATCTACATCACGGTCC -3'
(R):5'- GGAGTTTCCAAGCAGTTCATAG -3'

Posted On

2013-07-30