Incidental Mutation 'R8282:Slc6a3'
ID638270
Institutional Source Beutler Lab
Gene Symbol Slc6a3
Ensembl Gene ENSMUSG00000021609
Gene Namesolute carrier family 6 (neurotransmitter transporter, dopamine), member 3
SynonymsDat1, DAT
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8282 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location73536747-73578672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73557081 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 230 (D230E)
Ref Sequence ENSEMBL: ENSMUSP00000022100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022100]
Predicted Effect probably benign
Transcript: ENSMUST00000022100
AA Change: D230E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000022100
Gene: ENSMUSG00000021609
AA Change: D230E

DomainStartEndE-ValueType
Pfam:SNF 60 582 8.1e-237 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dopamine transporter which is a member of the sodium- and chloride-dependent neurotransmitter transporter family. The 3' UTR of this gene contains a 40 bp tandem repeat, referred to as a variable number tandem repeat or VNTR, which can be present in 3 to 11 copies. Variation in the number of repeats is associated with idiopathic epilepsy, attention-deficit hyperactivity disorder, dependence on alcohol and cocaine, susceptibility to Parkinson disease and protection against nicotine dependence.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit dwarfism, hyperactivity (especially in a novel environment), 5-fold higher extracellular dopamine levels, impaired spatial cognitive function, anterior pituitary hypoplasia, and failure to lactate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6330408A02Rik T C 7: 13,261,610 M207V probably benign Het
Adcy10 T A 1: 165,510,337 D173E probably benign Het
Ahctf1 T C 1: 179,777,806 D721G possibly damaging Het
Allc T C 12: 28,557,357 T299A probably damaging Het
Axl C T 7: 25,763,954 D633N probably benign Het
Brf2 G T 8: 27,124,593 R30S Het
Bsn A G 9: 108,107,691 S283P possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces1d A T 8: 93,186,112 S233T possibly damaging Het
Chst15 T A 7: 132,270,150 H134L probably benign Het
Col14a1 A G 15: 55,420,880 T846A unknown Het
Cwh43 A T 5: 73,434,229 D555V probably damaging Het
Cyld C A 8: 88,705,415 P14T probably benign Het
Dctn1 G A 6: 83,199,756 R1264H possibly damaging Het
Dkk3 T A 7: 112,118,282 S327C probably damaging Het
Dnmbp T G 19: 43,890,566 H22P unknown Het
Fabp4 T A 3: 10,205,282 T103S probably benign Het
Fam129b A G 2: 32,919,017 E205G probably benign Het
Fam43a T C 16: 30,601,288 L230P probably damaging Het
Fam46c A G 3: 100,473,011 V143A probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fank1 T A 7: 133,876,764 Y186N probably damaging Het
Fbxo8 G A 8: 56,591,520 R286K possibly damaging Het
Fmnl2 G A 2: 53,107,666 probably null Het
Gli2 T A 1: 118,837,971 S817C probably damaging Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm13212 A T 4: 145,622,977 D328V possibly damaging Het
Gm4981 T G 10: 58,236,326 Q22P possibly damaging Het
Gstt2 C G 10: 75,832,457 A155P probably benign Het
Ints9 T A 14: 65,007,308 M213K probably benign Het
Jak1 G A 4: 101,179,541 R301* probably null Het
Kdsr T C 1: 106,724,997 T302A probably benign Het
Khsrp T C 17: 57,024,123 E460G probably damaging Het
Larp1b G A 3: 41,036,810 R193H probably damaging Het
Nedd4l A G 18: 65,191,489 K487R probably damaging Het
Nwd1 T A 8: 72,704,952 S1193T probably damaging Het
Olfr1122 A T 2: 87,388,508 T268S probably benign Het
Olfr195 T A 16: 59,149,166 C105* probably null Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Padi1 T C 4: 140,814,703 H636R probably damaging Het
Pdilt A G 7: 119,498,070 I266T probably damaging Het
Rell2 A T 18: 37,957,612 Q114L probably benign Het
Rfc1 A G 5: 65,268,946 probably null Het
Rpia T C 6: 70,771,018 N265D possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGCGGCGG 7: 97,579,920 probably null Het
Samd12 T C 15: 53,860,249 D16G probably damaging Het
Slc25a54 T C 3: 109,098,689 probably null Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Synpo2l A G 14: 20,661,136 V472A probably benign Het
Taf6l A G 19: 8,773,350 I120T possibly damaging Het
Trappc11 T C 8: 47,516,589 D328G probably damaging Het
Trp53bp1 A G 2: 121,199,042 S1836P probably damaging Het
Ugt2b37 G A 5: 87,254,581 L64F probably benign Het
Vmn2r56 A T 7: 12,715,674 Y212* probably null Het
Zfp648 T A 1: 154,204,789 H231Q probably benign Het
Zscan4d T A 7: 11,162,442 T334S possibly damaging Het
Other mutations in Slc6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc6a3 APN 13 73544741 missense probably damaging 1.00
IGL01524:Slc6a3 APN 13 73538549 missense probably benign 0.01
IGL02015:Slc6a3 APN 13 73544714 missense possibly damaging 0.60
IGL03008:Slc6a3 APN 13 73558285 critical splice donor site probably null
IGL03029:Slc6a3 APN 13 73538697 missense probably damaging 1.00
IGL03064:Slc6a3 APN 13 73571466 missense probably damaging 0.99
IGL03272:Slc6a3 APN 13 73540929 missense probably damaging 0.98
IGL03294:Slc6a3 APN 13 73557181 critical splice donor site probably null
IGL03345:Slc6a3 APN 13 73571514 missense probably benign
IGL03410:Slc6a3 APN 13 73538657 missense probably benign 0.03
disney UTSW 13 73544884 missense probably benign
dopey UTSW 13 73560959 missense probably damaging 1.00
Dopey2 UTSW 13 73544817 missense probably damaging 1.00
Stiff UTSW 13 73557050 missense possibly damaging 0.85
PIT4382001:Slc6a3 UTSW 13 73571523 missense probably benign 0.35
R0024:Slc6a3 UTSW 13 73540837 splice site probably benign
R0125:Slc6a3 UTSW 13 73569979 splice site probably benign
R0180:Slc6a3 UTSW 13 73562336 missense probably damaging 1.00
R0288:Slc6a3 UTSW 13 73560928 missense probably damaging 1.00
R0322:Slc6a3 UTSW 13 73560926 missense possibly damaging 0.61
R0349:Slc6a3 UTSW 13 73567557 missense probably damaging 1.00
R0411:Slc6a3 UTSW 13 73557050 missense possibly damaging 0.85
R0594:Slc6a3 UTSW 13 73538642 missense probably damaging 0.99
R0680:Slc6a3 UTSW 13 73538727 missense probably damaging 1.00
R1099:Slc6a3 UTSW 13 73567641 missense probably benign 0.21
R1109:Slc6a3 UTSW 13 73557080 missense probably benign 0.00
R1791:Slc6a3 UTSW 13 73566292 missense possibly damaging 0.82
R3916:Slc6a3 UTSW 13 73562308 missense probably benign 0.00
R4279:Slc6a3 UTSW 13 73544834 missense possibly damaging 0.90
R4368:Slc6a3 UTSW 13 73560912 nonsense probably null
R4520:Slc6a3 UTSW 13 73540856 missense possibly damaging 0.95
R4666:Slc6a3 UTSW 13 73538581 missense possibly damaging 0.47
R4675:Slc6a3 UTSW 13 73544817 missense probably damaging 1.00
R4716:Slc6a3 UTSW 13 73557076 missense probably benign 0.04
R5243:Slc6a3 UTSW 13 73571451 missense possibly damaging 0.61
R5355:Slc6a3 UTSW 13 73560959 missense probably damaging 1.00
R5681:Slc6a3 UTSW 13 73538735 missense probably damaging 0.99
R5737:Slc6a3 UTSW 13 73544804 missense probably damaging 0.99
R6142:Slc6a3 UTSW 13 73544783 missense probably benign 0.00
R6471:Slc6a3 UTSW 13 73544884 missense probably benign
R7168:Slc6a3 UTSW 13 73571472 missense probably benign 0.00
R7403:Slc6a3 UTSW 13 73562427 critical splice donor site probably null
R8359:Slc6a3 UTSW 13 73544883 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGCACCTAGCTTCTCTGTC -3'
(R):5'- ATCTGCTCACACACCATGGC -3'

Sequencing Primer
(F):5'- TCTGTCCATCTTAACAGAGTTCAG -3'
(R):5'- ACACACCATGGCCATATGTTTATC -3'
Posted On2020-07-28