Incidental Mutation 'R8282:Ints9'
ID 638272
Institutional Source Beutler Lab
Gene Symbol Ints9
Ensembl Gene ENSMUSG00000021975
Gene Name integrator complex subunit 9
Synonyms D14Ertd231e
MMRRC Submission 067705-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8282 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 65187494-65277284 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65244757 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 213 (M213K)
Ref Sequence ENSEMBL: ENSMUSP00000045552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043914]
AlphaFold Q8K114
Predicted Effect probably benign
Transcript: ENSMUST00000043914
AA Change: M213K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000045552
Gene: ENSMUSG00000021975
AA Change: M213K

DomainStartEndE-ValueType
Pfam:Lactamase_B_6 91 289 1.2e-17 PFAM
Beta-Casp 334 462 7.65e-16 SMART
low complexity region 583 596 N/A INTRINSIC
low complexity region 672 682 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 T A 1: 165,337,906 (GRCm39) D173E probably benign Het
Ahctf1 T C 1: 179,605,371 (GRCm39) D721G possibly damaging Het
Allc T C 12: 28,607,356 (GRCm39) T299A probably damaging Het
Ankrd55 T A 13: 112,459,575 (GRCm39) probably benign Het
Axl C T 7: 25,463,379 (GRCm39) D633N probably benign Het
Brf2 G T 8: 27,614,621 (GRCm39) R30S Het
Bsn A G 9: 107,984,890 (GRCm39) S283P possibly damaging Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Ces1d A T 8: 93,912,740 (GRCm39) S233T possibly damaging Het
Chst15 T A 7: 131,871,879 (GRCm39) H134L probably benign Het
Col14a1 A G 15: 55,284,276 (GRCm39) T846A unknown Het
Cwh43 A T 5: 73,591,572 (GRCm39) D555V probably damaging Het
Cyld C A 8: 89,432,043 (GRCm39) P14T probably benign Het
Dctn1 G A 6: 83,176,738 (GRCm39) R1264H possibly damaging Het
Dkk3 T A 7: 111,717,489 (GRCm39) S327C probably damaging Het
Dnmbp T G 19: 43,879,005 (GRCm39) H22P unknown Het
Duxf4 T G 10: 58,072,148 (GRCm39) Q22P possibly damaging Het
Fabp4 T A 3: 10,270,342 (GRCm39) T103S probably benign Het
Fam43a T C 16: 30,420,106 (GRCm39) L230P probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 75,874,624 (GRCm39) probably benign Het
Fank1 T A 7: 133,478,493 (GRCm39) Y186N probably damaging Het
Fbxo8 G A 8: 57,044,555 (GRCm39) R286K possibly damaging Het
Fmnl2 G A 2: 52,997,678 (GRCm39) probably null Het
Gli2 T A 1: 118,765,701 (GRCm39) S817C probably damaging Het
Gm10110 C T 14: 90,135,677 (GRCm39) V76M noncoding transcript Het
Gstt2 C G 10: 75,668,291 (GRCm39) A155P probably benign Het
Jak1 G A 4: 101,036,738 (GRCm39) R301* probably null Het
Kdsr T C 1: 106,652,727 (GRCm39) T302A probably benign Het
Khsrp T C 17: 57,331,123 (GRCm39) E460G probably damaging Het
Larp1b G A 3: 40,991,245 (GRCm39) R193H probably damaging Het
Nedd4l A G 18: 65,324,560 (GRCm39) K487R probably damaging Het
Niban2 A G 2: 32,809,029 (GRCm39) E205G probably benign Het
Nwd1 T A 8: 73,431,580 (GRCm39) S1193T probably damaging Het
Or10ag57 A T 2: 87,218,852 (GRCm39) T268S probably benign Het
Or5k3 T A 16: 58,969,529 (GRCm39) C105* probably null Het
Or8b54 G A 9: 38,686,577 (GRCm39) V9M noncoding transcript Het
Padi1 T C 4: 140,542,014 (GRCm39) H636R probably damaging Het
Pdilt A G 7: 119,097,293 (GRCm39) I266T probably damaging Het
Rell2 A T 18: 38,090,665 (GRCm39) Q114L probably benign Het
Rfc1 A G 5: 65,426,289 (GRCm39) probably null Het
Rpia T C 6: 70,748,002 (GRCm39) N265D possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGCGGCGG 7: 97,229,127 (GRCm39) probably null Het
Samd12 T C 15: 53,723,645 (GRCm39) D16G probably damaging Het
Slc25a54 T C 3: 109,006,005 (GRCm39) probably null Het
Slc6a3 T A 13: 73,705,200 (GRCm39) D230E probably benign Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Synpo2l A G 14: 20,711,204 (GRCm39) V472A probably benign Het
Taf6l A G 19: 8,750,714 (GRCm39) I120T possibly damaging Het
Tent5c A G 3: 100,380,327 (GRCm39) V143A probably damaging Het
Trappc11 T C 8: 47,969,624 (GRCm39) D328G probably damaging Het
Trp53bp1 A G 2: 121,029,523 (GRCm39) S1836P probably damaging Het
Ugt2b37 G A 5: 87,402,440 (GRCm39) L64F probably benign Het
Vmn2r56 A T 7: 12,449,601 (GRCm39) Y212* probably null Het
Vps54 T A 11: 21,250,464 (GRCm39) probably benign Het
Zfp268 A T 4: 145,349,547 (GRCm39) D328V possibly damaging Het
Zfp648 T A 1: 154,080,535 (GRCm39) H231Q probably benign Het
Zscan4d T A 7: 10,896,369 (GRCm39) T334S possibly damaging Het
Zswim9 T C 7: 12,995,536 (GRCm39) M207V probably benign Het
Other mutations in Ints9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ints9 APN 14 65,274,870 (GRCm39) missense probably benign 0.00
IGL02374:Ints9 APN 14 65,276,782 (GRCm39) missense probably benign 0.00
IGL02728:Ints9 APN 14 65,230,457 (GRCm39) missense probably damaging 1.00
IGL02992:Ints9 APN 14 65,217,613 (GRCm39) missense probably benign 0.08
IGL03151:Ints9 APN 14 65,269,789 (GRCm39) missense possibly damaging 0.86
R0437:Ints9 UTSW 14 65,223,818 (GRCm39) splice site probably benign
R0582:Ints9 UTSW 14 65,217,598 (GRCm39) missense probably damaging 1.00
R1525:Ints9 UTSW 14 65,232,460 (GRCm39) missense probably benign 0.05
R1569:Ints9 UTSW 14 65,217,571 (GRCm39) missense possibly damaging 0.91
R1835:Ints9 UTSW 14 65,269,705 (GRCm39) missense probably damaging 1.00
R1839:Ints9 UTSW 14 65,253,979 (GRCm39) missense probably damaging 1.00
R1862:Ints9 UTSW 14 65,263,862 (GRCm39) missense probably benign
R1892:Ints9 UTSW 14 65,257,872 (GRCm39) missense probably benign 0.08
R2146:Ints9 UTSW 14 65,223,792 (GRCm39) missense possibly damaging 0.71
R2285:Ints9 UTSW 14 65,245,446 (GRCm39) missense possibly damaging 0.61
R3015:Ints9 UTSW 14 65,187,727 (GRCm39) missense probably benign 0.00
R4133:Ints9 UTSW 14 65,228,003 (GRCm39) missense probably benign
R4180:Ints9 UTSW 14 65,230,430 (GRCm39) missense probably damaging 1.00
R4509:Ints9 UTSW 14 65,266,381 (GRCm39) missense possibly damaging 0.96
R4510:Ints9 UTSW 14 65,266,381 (GRCm39) missense possibly damaging 0.96
R4511:Ints9 UTSW 14 65,266,381 (GRCm39) missense possibly damaging 0.96
R4608:Ints9 UTSW 14 65,269,729 (GRCm39) missense possibly damaging 0.82
R5023:Ints9 UTSW 14 65,217,677 (GRCm39) missense probably damaging 1.00
R5117:Ints9 UTSW 14 65,230,540 (GRCm39) nonsense probably null
R5261:Ints9 UTSW 14 65,245,521 (GRCm39) missense probably benign 0.25
R5582:Ints9 UTSW 14 65,266,345 (GRCm39) missense possibly damaging 0.83
R5990:Ints9 UTSW 14 65,276,777 (GRCm39) missense probably damaging 1.00
R6009:Ints9 UTSW 14 65,245,531 (GRCm39) missense probably benign 0.43
R6241:Ints9 UTSW 14 65,217,659 (GRCm39) missense possibly damaging 0.90
R6351:Ints9 UTSW 14 65,230,456 (GRCm39) missense probably damaging 0.98
R6821:Ints9 UTSW 14 65,274,907 (GRCm39) missense probably benign 0.20
R7422:Ints9 UTSW 14 65,269,747 (GRCm39) missense possibly damaging 0.93
R7442:Ints9 UTSW 14 65,232,513 (GRCm39) nonsense probably null
R7475:Ints9 UTSW 14 65,263,914 (GRCm39) missense probably null 0.23
R8183:Ints9 UTSW 14 65,273,902 (GRCm39) missense probably damaging 0.98
R8223:Ints9 UTSW 14 65,257,809 (GRCm39) missense possibly damaging 0.94
R8314:Ints9 UTSW 14 65,266,479 (GRCm39) missense probably damaging 1.00
R8341:Ints9 UTSW 14 65,273,863 (GRCm39) missense probably benign 0.14
R8548:Ints9 UTSW 14 65,269,770 (GRCm39) missense probably benign 0.39
R9356:Ints9 UTSW 14 65,269,770 (GRCm39) missense probably benign 0.39
R9434:Ints9 UTSW 14 65,245,506 (GRCm39) missense probably benign 0.00
Z1176:Ints9 UTSW 14 65,274,903 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACTGGACTGTGGGGATTATCAG -3'
(R):5'- AATCTGCCTGCATTCTTCCTGG -3'

Sequencing Primer
(F):5'- CTCACAGTAAGAGTCCTGGGATTAC -3'
(R):5'- TGGCGCTCACACAAAGG -3'
Posted On 2020-07-28