Incidental Mutation 'R8282:Col14a1'
ID638275
Institutional Source Beutler Lab
Gene Symbol Col14a1
Ensembl Gene ENSMUSG00000022371
Gene Namecollagen, type XIV, alpha 1
Synonyms5730412L22Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8282 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location55307750-55520803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55420880 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 846 (T846A)
Ref Sequence ENSEMBL: ENSMUSP00000105850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023053] [ENSMUST00000110217] [ENSMUST00000110221]
Predicted Effect unknown
Transcript: ENSMUST00000023053
AA Change: T849A
SMART Domains Protein: ENSMUSP00000023053
Gene: ENSMUSG00000022371
AA Change: T849A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 818 6.2e-7 SMART
FN3 830 909 1.45e-7 SMART
FN3 920 999 3.59e0 SMART
low complexity region 1010 1022 N/A INTRINSIC
VWA 1031 1211 2.02e-59 SMART
TSPN 1230 1425 1.19e-66 SMART
Pfam:Collagen 1461 1515 2.9e-8 PFAM
Pfam:Collagen 1513 1571 6.3e-9 PFAM
Pfam:Collagen 1555 1615 8.5e-10 PFAM
Pfam:Collagen 1653 1709 7.6e-10 PFAM
Pfam:Collagen 1707 1762 2.6e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110217
AA Change: T850A
SMART Domains Protein: ENSMUSP00000105846
Gene: ENSMUSG00000022371
AA Change: T850A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 819 5.4e-7 SMART
FN3 831 910 1.45e-7 SMART
FN3 921 1000 3.59e0 SMART
low complexity region 1011 1023 N/A INTRINSIC
VWA 1032 1212 2.02e-59 SMART
TSPN 1231 1426 1.19e-66 SMART
Pfam:Collagen 1462 1516 2.5e-8 PFAM
Pfam:Collagen 1514 1572 5.4e-9 PFAM
Pfam:Collagen 1556 1616 7.3e-10 PFAM
Pfam:Collagen 1654 1710 6.5e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110221
AA Change: T846A
SMART Domains Protein: ENSMUSP00000105850
Gene: ENSMUSG00000022371
AA Change: T846A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 815 7.12e-7 SMART
FN3 827 906 1.45e-7 SMART
FN3 917 996 3.59e0 SMART
low complexity region 1007 1019 N/A INTRINSIC
VWA 1028 1208 2.02e-59 SMART
TSPN 1227 1422 1.19e-66 SMART
Pfam:Collagen 1458 1512 8.2e-9 PFAM
Pfam:Collagen 1510 1568 1.8e-9 PFAM
Pfam:Collagen 1552 1612 2.4e-10 PFAM
Pfam:Collagen 1650 1706 2.2e-10 PFAM
Pfam:Collagen 1704 1759 7.5e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIV collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XIV collagen interacts with the fibril surface and is involved in the regulation of fibrillogenesis. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null mutation display abnormal tendon morphology and abnormal biomechanical properties of the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6330408A02Rik T C 7: 13,261,610 M207V probably benign Het
Adcy10 T A 1: 165,510,337 D173E probably benign Het
Ahctf1 T C 1: 179,777,806 D721G possibly damaging Het
Allc T C 12: 28,557,357 T299A probably damaging Het
Axl C T 7: 25,763,954 D633N probably benign Het
Brf2 G T 8: 27,124,593 R30S Het
Bsn A G 9: 108,107,691 S283P possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Ces1d A T 8: 93,186,112 S233T possibly damaging Het
Chst15 T A 7: 132,270,150 H134L probably benign Het
Cwh43 A T 5: 73,434,229 D555V probably damaging Het
Cyld C A 8: 88,705,415 P14T probably benign Het
Dctn1 G A 6: 83,199,756 R1264H possibly damaging Het
Dkk3 T A 7: 112,118,282 S327C probably damaging Het
Dnmbp T G 19: 43,890,566 H22P unknown Het
Fabp4 T A 3: 10,205,282 T103S probably benign Het
Fam129b A G 2: 32,919,017 E205G probably benign Het
Fam43a T C 16: 30,601,288 L230P probably damaging Het
Fam46c A G 3: 100,473,011 V143A probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fank1 T A 7: 133,876,764 Y186N probably damaging Het
Fbxo8 G A 8: 56,591,520 R286K possibly damaging Het
Fmnl2 G A 2: 53,107,666 probably null Het
Gli2 T A 1: 118,837,971 S817C probably damaging Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm13212 A T 4: 145,622,977 D328V possibly damaging Het
Gm4981 T G 10: 58,236,326 Q22P possibly damaging Het
Gstt2 C G 10: 75,832,457 A155P probably benign Het
Ints9 T A 14: 65,007,308 M213K probably benign Het
Jak1 G A 4: 101,179,541 R301* probably null Het
Kdsr T C 1: 106,724,997 T302A probably benign Het
Khsrp T C 17: 57,024,123 E460G probably damaging Het
Larp1b G A 3: 41,036,810 R193H probably damaging Het
Nedd4l A G 18: 65,191,489 K487R probably damaging Het
Nwd1 T A 8: 72,704,952 S1193T probably damaging Het
Olfr1122 A T 2: 87,388,508 T268S probably benign Het
Olfr195 T A 16: 59,149,166 C105* probably null Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Padi1 T C 4: 140,814,703 H636R probably damaging Het
Pdilt A G 7: 119,498,070 I266T probably damaging Het
Rell2 A T 18: 37,957,612 Q114L probably benign Het
Rfc1 A G 5: 65,268,946 probably null Het
Rpia T C 6: 70,771,018 N265D possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGCGGCGG 7: 97,579,920 probably null Het
Samd12 T C 15: 53,860,249 D16G probably damaging Het
Slc25a54 T C 3: 109,098,689 probably null Het
Slc6a3 T A 13: 73,557,081 D230E probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Synpo2l A G 14: 20,661,136 V472A probably benign Het
Taf6l A G 19: 8,773,350 I120T possibly damaging Het
Trappc11 T C 8: 47,516,589 D328G probably damaging Het
Trp53bp1 A G 2: 121,199,042 S1836P probably damaging Het
Ugt2b37 G A 5: 87,254,581 L64F probably benign Het
Vmn2r56 A T 7: 12,715,674 Y212* probably null Het
Zfp648 T A 1: 154,204,789 H231Q probably benign Het
Zscan4d T A 7: 11,162,442 T334S possibly damaging Het
Other mutations in Col14a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Col14a1 APN 15 55411585 missense unknown
IGL01290:Col14a1 APN 15 55423507 missense unknown
IGL01300:Col14a1 APN 15 55467976 missense unknown
IGL01505:Col14a1 APN 15 55455223 missense unknown
IGL01533:Col14a1 APN 15 55420840 missense unknown
IGL01563:Col14a1 APN 15 55487941 missense unknown
IGL01650:Col14a1 APN 15 55406693 missense unknown
IGL01659:Col14a1 APN 15 55446172 unclassified probably benign
IGL01670:Col14a1 APN 15 55329266 missense unknown
IGL01760:Col14a1 APN 15 55423459 missense unknown
IGL01803:Col14a1 APN 15 55418814 missense unknown
IGL01966:Col14a1 APN 15 55448725 unclassified probably benign
IGL01990:Col14a1 APN 15 55363463 missense unknown
IGL02124:Col14a1 APN 15 55463703 missense unknown
IGL02138:Col14a1 APN 15 55420835 missense unknown
IGL02192:Col14a1 APN 15 55362402 missense unknown
IGL02326:Col14a1 APN 15 55418797 missense unknown
IGL02335:Col14a1 APN 15 55463769 splice site probably benign
IGL02407:Col14a1 APN 15 55448876 splice site probably benign
IGL02486:Col14a1 APN 15 55388696 splice site probably benign
IGL02537:Col14a1 APN 15 55344914 nonsense probably null
IGL02567:Col14a1 APN 15 55344961 critical splice donor site probably null
IGL02643:Col14a1 APN 15 55420862 missense unknown
IGL02669:Col14a1 APN 15 55418782 missense unknown
IGL02673:Col14a1 APN 15 55418782 missense unknown
IGL02674:Col14a1 APN 15 55418782 missense unknown
IGL03201:Col14a1 APN 15 55408904 missense unknown
IGL03334:Col14a1 APN 15 55448821 unclassified probably benign
IGL03370:Col14a1 APN 15 55488541 splice site probably null
IGL03385:Col14a1 APN 15 55410204 missense unknown
IGL03385:Col14a1 APN 15 55471708 missense unknown
PIT4131001:Col14a1 UTSW 15 55448876 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0173:Col14a1 UTSW 15 55488532 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0359:Col14a1 UTSW 15 55407868 splice site probably benign
R0391:Col14a1 UTSW 15 55446259 unclassified probably benign
R0468:Col14a1 UTSW 15 55388646 missense unknown
R0652:Col14a1 UTSW 15 55344882 missense unknown
R0692:Col14a1 UTSW 15 55341738 missense unknown
R0745:Col14a1 UTSW 15 55338417 missense unknown
R1006:Col14a1 UTSW 15 55519935 missense probably benign 0.04
R1331:Col14a1 UTSW 15 55410188 missense unknown
R1537:Col14a1 UTSW 15 55380767 missense unknown
R1557:Col14a1 UTSW 15 55388579 missense unknown
R1721:Col14a1 UTSW 15 55447462 unclassified probably benign
R1737:Col14a1 UTSW 15 55344961 critical splice donor site probably benign
R1837:Col14a1 UTSW 15 55382495 missense unknown
R1867:Col14a1 UTSW 15 55447462 unclassified probably benign
R1868:Col14a1 UTSW 15 55447462 unclassified probably benign
R1991:Col14a1 UTSW 15 55449940 missense unknown
R2020:Col14a1 UTSW 15 55446181 unclassified probably benign
R2103:Col14a1 UTSW 15 55449940 missense unknown
R2116:Col14a1 UTSW 15 55407764 missense unknown
R2163:Col14a1 UTSW 15 55444645 unclassified probably benign
R2207:Col14a1 UTSW 15 55463686 missense unknown
R2215:Col14a1 UTSW 15 55380842 missense unknown
R2264:Col14a1 UTSW 15 55466690 splice site probably null
R2383:Col14a1 UTSW 15 55447517 unclassified probably benign
R2397:Col14a1 UTSW 15 55338439 missense unknown
R2422:Col14a1 UTSW 15 55449922 missense unknown
R3793:Col14a1 UTSW 15 55363513 missense unknown
R4082:Col14a1 UTSW 15 55437033 missense unknown
R4112:Col14a1 UTSW 15 55363559 missense unknown
R4519:Col14a1 UTSW 15 55388579 missense unknown
R4628:Col14a1 UTSW 15 55449833 nonsense probably null
R4692:Col14a1 UTSW 15 55423468 missense unknown
R4696:Col14a1 UTSW 15 55372602 missense unknown
R4749:Col14a1 UTSW 15 55452336 missense unknown
R5324:Col14a1 UTSW 15 55338445 missense unknown
R5382:Col14a1 UTSW 15 55362436 missense unknown
R5634:Col14a1 UTSW 15 55518298 missense probably damaging 1.00
R5781:Col14a1 UTSW 15 55423512 missense unknown
R5828:Col14a1 UTSW 15 55436976 missense unknown
R5873:Col14a1 UTSW 15 55445786 unclassified probably benign
R5966:Col14a1 UTSW 15 55452383 critical splice donor site probably null
R6106:Col14a1 UTSW 15 55520008 missense probably damaging 1.00
R6135:Col14a1 UTSW 15 55380850 missense unknown
R6319:Col14a1 UTSW 15 55516169 missense probably damaging 0.99
R6475:Col14a1 UTSW 15 55445822 unclassified probably benign
R6540:Col14a1 UTSW 15 55372581 missense unknown
R6893:Col14a1 UTSW 15 55444648 unclassified probably benign
R6992:Col14a1 UTSW 15 55411562 splice site probably null
R7284:Col14a1 UTSW 15 55518319 missense probably damaging 1.00
R7404:Col14a1 UTSW 15 55388628 nonsense probably null
R7655:Col14a1 UTSW 15 55362450 missense unknown
R7656:Col14a1 UTSW 15 55362450 missense unknown
R7715:Col14a1 UTSW 15 55487983 missense unknown
R7841:Col14a1 UTSW 15 55382480 missense unknown
R7861:Col14a1 UTSW 15 55444616 missense unknown
R7866:Col14a1 UTSW 15 55388620 missense unknown
R7902:Col14a1 UTSW 15 55501436 missense probably benign 0.16
R8041:Col14a1 UTSW 15 55455230 missense unknown
R8159:Col14a1 UTSW 15 55427928 missense unknown
R8224:Col14a1 UTSW 15 55407741 missense unknown
X0023:Col14a1 UTSW 15 55423447 missense unknown
X0063:Col14a1 UTSW 15 55410215 missense unknown
Z1177:Col14a1 UTSW 15 55372570 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCCCACTGTGAACTTTGTTG -3'
(R):5'- TTTGCATCATTGAGCTGGCG -3'

Sequencing Primer
(F):5'- GTGAACTTTGTTGATGTTTTATTTGC -3'
(R):5'- ACTTGCACGTTCTGGCAAAG -3'
Posted On2020-07-28