Incidental Mutation 'R0724:Olfr735'
ID 63828
Institutional Source Beutler Lab
Gene Symbol Olfr735
Ensembl Gene ENSMUSG00000046210
Gene Name olfactory receptor 735
Synonyms MOR243-1, GA_x6K02T2PMLR-6042130-6041183
MMRRC Submission 038906-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.122) question?
Stock # R0724 (G1)
Quality Score 116
Status Validated
Chromosome 14
Chromosomal Location 50342612-50348872 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 50345917 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 175 (V175A)
Ref Sequence ENSEMBL: ENSMUSP00000056851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049729] [ENSMUST00000216634]
AlphaFold Q7TRM4
Predicted Effect possibly damaging
Transcript: ENSMUST00000049729
AA Change: V175A

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056851
Gene: ENSMUSG00000046210
AA Change: V175A

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
Pfam:7tm_4 70 345 1.6e-49 PFAM
Pfam:7tm_1 80 345 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206546
Predicted Effect possibly damaging
Transcript: ENSMUST00000216634
AA Change: V144A

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1901 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 (GRCm38) E136G probably benign Het
Adgre4 T A 17: 55,852,281 (GRCm38) S655R probably benign Het
Ak7 T A 12: 105,710,254 (GRCm38) V71E probably benign Het
Ank2 C T 3: 126,962,337 (GRCm38) R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 (GRCm38) T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 (GRCm38) I109N possibly damaging Het
Camta1 A G 4: 151,077,892 (GRCm38) I119T probably damaging Het
Carm1 A G 9: 21,587,374 (GRCm38) Y504C probably damaging Het
Casp1 C T 9: 5,303,077 (GRCm38) P177L probably benign Het
Ccdc122 C A 14: 77,092,077 (GRCm38) probably benign Het
Ces1a A G 8: 93,039,513 (GRCm38) S158P probably damaging Het
Ces3a T A 8: 105,050,195 (GRCm38) D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 (GRCm38) D583A possibly damaging Het
Corin A G 5: 72,332,795 (GRCm38) probably benign Het
Cryba1 T C 11: 77,719,457 (GRCm38) D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 (GRCm38) probably null Het
Dis3l T C 9: 64,307,126 (GRCm38) T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 (GRCm38) E653G probably benign Het
Dst A G 1: 34,188,677 (GRCm38) I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 (GRCm38) T64A probably benign Het
Emp2 C T 16: 10,284,615 (GRCm38) C111Y probably benign Het
Enam A G 5: 88,501,994 (GRCm38) Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 (GRCm38) C1328S probably benign Het
Gata3 T C 2: 9,874,575 (GRCm38) T197A probably benign Het
Gm1043 A G 5: 37,187,229 (GRCm38) T212A probably damaging Het
Gm15448 T C 7: 3,816,872 (GRCm38) N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 (GRCm38) probably benign Het
Hand1 T C 11: 57,831,680 (GRCm38) H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 (GRCm38) Y239* probably null Het
Hoxc12 A G 15: 102,937,055 (GRCm38) Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 (GRCm38) I143V probably benign Het
Klhdc2 C A 12: 69,297,048 (GRCm38) F18L probably benign Het
Kpnb1 T C 11: 97,178,304 (GRCm38) Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 (GRCm38) N315I probably damaging Het
Map3k10 A C 7: 27,668,355 (GRCm38) V286G probably damaging Het
Myo7b G A 18: 32,005,549 (GRCm38) probably benign Het
Nlrp2 G T 7: 5,319,222 (GRCm38) L809I probably damaging Het
Oacyl T C 18: 65,737,825 (GRCm38) probably benign Het
Paxbp1 T A 16: 91,036,536 (GRCm38) D270V probably damaging Het
Pdia3 G A 2: 121,432,377 (GRCm38) G275S probably damaging Het
Plcb3 G A 19: 6,963,392 (GRCm38) R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 (GRCm38) S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 (GRCm38) S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 (GRCm38) I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 (GRCm38) probably benign Het
Smim14 A G 5: 65,453,339 (GRCm38) probably benign Het
Sost C T 11: 101,966,918 (GRCm38) C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 (GRCm38) A727E probably damaging Het
Thoc1 T C 18: 9,963,829 (GRCm38) L144P probably damaging Het
Tmem132b A T 5: 125,783,421 (GRCm38) T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 (GRCm38) H239Y probably benign Het
Tshr T C 12: 91,538,286 (GRCm38) F666S probably damaging Het
Wdr1 A G 5: 38,540,862 (GRCm38) V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 (GRCm38) W416R probably damaging Het
Other mutations in Olfr735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr735 APN 14 50,345,614 (GRCm38) missense probably damaging 0.99
IGL01655:Olfr735 APN 14 50,346,184 (GRCm38) missense probably benign 0.01
IGL02838:Olfr735 APN 14 50,345,855 (GRCm38) missense probably damaging 1.00
IGL02874:Olfr735 APN 14 50,346,126 (GRCm38) missense probably damaging 1.00
R0609:Olfr735 UTSW 14 50,345,926 (GRCm38) missense probably damaging 1.00
R0839:Olfr735 UTSW 14 50,346,088 (GRCm38) missense probably damaging 0.98
R1766:Olfr735 UTSW 14 50,346,220 (GRCm38) missense probably damaging 1.00
R1799:Olfr735 UTSW 14 50,346,080 (GRCm38) missense probably benign 0.32
R4934:Olfr735 UTSW 14 50,345,888 (GRCm38) missense probably damaging 1.00
R5753:Olfr735 UTSW 14 50,345,588 (GRCm38) missense probably damaging 0.96
R5996:Olfr735 UTSW 14 50,345,512 (GRCm38) missense possibly damaging 0.89
R6555:Olfr735 UTSW 14 50,345,846 (GRCm38) nonsense probably null
R6736:Olfr735 UTSW 14 50,345,448 (GRCm38) missense probably damaging 1.00
R7841:Olfr735 UTSW 14 50,345,828 (GRCm38) missense probably benign 0.09
R7922:Olfr735 UTSW 14 50,346,415 (GRCm38) missense probably benign 0.03
R8190:Olfr735 UTSW 14 50,345,722 (GRCm38) missense probably damaging 0.99
R8308:Olfr735 UTSW 14 50,345,465 (GRCm38) missense probably benign 0.06
R8560:Olfr735 UTSW 14 50,346,337 (GRCm38) missense probably benign 0.12
X0019:Olfr735 UTSW 14 50,345,806 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATCAGGCTGACCACCGTCAAG -3'
(R):5'- GTGGCTGTACCCAAAATGCTAGGAG -3'

Sequencing Primer
(F):5'- GTATGCCACTGTTAGAGACCATC -3'
(R):5'- AGATTTCCTACAGAAGGAGAAGAC -3'
Posted On 2013-07-30