Incidental Mutation 'R0724:Olfr735'
ID63828
Institutional Source Beutler Lab
Gene Symbol Olfr735
Ensembl Gene ENSMUSG00000046210
Gene Nameolfactory receptor 735
SynonymsMOR243-1, GA_x6K02T2PMLR-6042130-6041183
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R0724 (G1)
Quality Score116
Status Validated
Chromosome14
Chromosomal Location50342612-50348872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50345917 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 175 (V175A)
Ref Sequence ENSEMBL: ENSMUSP00000056851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049729] [ENSMUST00000216634]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049729
AA Change: V175A

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056851
Gene: ENSMUSG00000046210
AA Change: V175A

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
Pfam:7tm_4 70 345 1.6e-49 PFAM
Pfam:7tm_1 80 345 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206546
Predicted Effect possibly damaging
Transcript: ENSMUST00000216634
AA Change: V144A

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1901 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Olfr735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr735 APN 14 50345614 missense probably damaging 0.99
IGL01655:Olfr735 APN 14 50346184 missense probably benign 0.01
IGL02838:Olfr735 APN 14 50345855 missense probably damaging 1.00
IGL02874:Olfr735 APN 14 50346126 missense probably damaging 1.00
R0609:Olfr735 UTSW 14 50345926 missense probably damaging 1.00
R0839:Olfr735 UTSW 14 50346088 missense probably damaging 0.98
R1766:Olfr735 UTSW 14 50346220 missense probably damaging 1.00
R1799:Olfr735 UTSW 14 50346080 missense probably benign 0.32
R4934:Olfr735 UTSW 14 50345888 missense probably damaging 1.00
R5753:Olfr735 UTSW 14 50345588 missense probably damaging 0.96
R5996:Olfr735 UTSW 14 50345512 missense possibly damaging 0.89
R6555:Olfr735 UTSW 14 50345846 nonsense probably null
R6736:Olfr735 UTSW 14 50345448 missense probably damaging 1.00
R7841:Olfr735 UTSW 14 50345828 missense probably benign 0.09
R7922:Olfr735 UTSW 14 50346415 missense probably benign 0.03
R8190:Olfr735 UTSW 14 50345722 missense probably damaging 0.99
R8308:Olfr735 UTSW 14 50345465 missense probably benign 0.06
R8560:Olfr735 UTSW 14 50346337 missense probably benign 0.12
X0019:Olfr735 UTSW 14 50345806 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATCAGGCTGACCACCGTCAAG -3'
(R):5'- GTGGCTGTACCCAAAATGCTAGGAG -3'

Sequencing Primer
(F):5'- GTATGCCACTGTTAGAGACCATC -3'
(R):5'- AGATTTCCTACAGAAGGAGAAGAC -3'
Posted On2013-07-30