Incidental Mutation 'R8283:Hnrnpl'
ID638308
Institutional Source Beutler Lab
Gene Symbol Hnrnpl
Ensembl Gene ENSMUSG00000015165
Gene Nameheterogeneous nuclear ribonucleoprotein L
SynonymsHnrpl, D830027H13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8283 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location28808541-28822266 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28814272 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 220 (V220A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038572] [ENSMUST00000172529] [ENSMUST00000172884] [ENSMUST00000174548] [ENSMUST00000174882]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038572
AA Change: V229A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049407
Gene: ENSMUSG00000015165
AA Change: V229A

DomainStartEndE-ValueType
low complexity region 3 57 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
RRM 100 169 9.8e-9 SMART
RRM 191 261 4.75e-7 SMART
low complexity region 314 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
RRM 380 449 5.09e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172529
AA Change: V99A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133932
Gene: ENSMUSG00000015165
AA Change: V99A

DomainStartEndE-ValueType
Blast:RRM 1 39 9e-20 BLAST
RRM 61 131 4.75e-7 SMART
low complexity region 184 209 N/A INTRINSIC
low complexity region 226 244 N/A INTRINSIC
RRM 250 319 5.09e-7 SMART
Blast:RRM_2 369 442 6e-17 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000172884
AA Change: V99A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134271
Gene: ENSMUSG00000015165
AA Change: V99A

DomainStartEndE-ValueType
Blast:RRM 1 39 1e-21 BLAST
SCOP:d1qm9a1 3 61 3e-3 SMART
Pfam:RRM_6 67 113 5.7e-5 PFAM
Pfam:RRM_1 70 113 1.3e-5 PFAM
Pfam:RRM_5 78 113 9.5e-14 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000134734
Gene: ENSMUSG00000015165
AA Change: V220A

DomainStartEndE-ValueType
low complexity region 4 49 N/A INTRINSIC
low complexity region 63 78 N/A INTRINSIC
RRM 92 161 9.8e-9 SMART
RRM 183 253 4.75e-7 SMART
low complexity region 339 368 N/A INTRINSIC
low complexity region 385 403 N/A INTRINSIC
RRM 409 478 5.09e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174548
AA Change: V229A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133728
Gene: ENSMUSG00000015165
AA Change: V229A

DomainStartEndE-ValueType
low complexity region 3 57 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
RRM 100 169 9.8e-9 SMART
RRM 191 261 4.75e-7 SMART
low complexity region 314 339 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
RRM 380 449 5.09e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174882
AA Change: V121A

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133952
Gene: ENSMUSG00000015165
AA Change: V121A

DomainStartEndE-ValueType
RRM 1 61 5.18e-1 SMART
RRM 83 153 4.75e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heterogeneous nuclear RNAs (hnRNAs) which include mRNA precursors and mature mRNAs are associated with specific proteins to form heterogenous ribonucleoprotein (hnRNP) complexes. Heterogeneous nuclear ribonucleoprotein L is among the proteins that are stably associated with hnRNP complexes and along with other hnRNP proteins is likely to play a major role in the formation, packaging, processing, and function of mRNA. Heterogeneous nuclear ribonucleoprotein L is present in the nucleoplasm as part of the HNRP complex. HNRP proteins have also been identified outside of the nucleoplasm. Exchange of hnRNP for mRNA-binding proteins accompanies transport of mRNA from the nucleus to the cytoplasm. Since HNRP proteins have been shown to shuttle between the nucleus and the cytoplasm, it is possible that they also have cytoplasmic functions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic letahlity after E3.5. Mice homozygous for a conditional allele activated in thymocytes exhibit decreased T cells in the periphery associated with impaired thymocyte chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C T 5: 8,806,086 P65S probably damaging Het
Adcy3 A T 12: 4,200,935 R565W probably damaging Het
Arl14 A T 3: 69,222,535 N5I probably benign Het
Arl6ip6 A G 2: 53,192,238 E39G possibly damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
Boc A T 16: 44,520,437 L50Q noncoding transcript Het
Calml3 A G 13: 3,804,097 V36A probably damaging Het
Ccdc183 G A 2: 25,612,148 A238V probably damaging Het
Ccndbp1 A G 2: 121,008,584 probably benign Het
Ccr9 A G 9: 123,779,631 Y126C probably damaging Het
Cdhr1 T C 14: 37,082,780 N491S probably benign Het
Celsr2 C T 3: 108,396,455 G2429D probably damaging Het
Cts6 T C 13: 61,201,643 T84A probably damaging Het
Dcpp2 T C 17: 23,899,410 probably null Het
Drosha A G 15: 12,890,501 I945V possibly damaging Het
Dsg1b A G 18: 20,391,906 Q133R probably benign Het
Enpp1 T A 10: 24,674,656 E174D probably benign Het
Esrrb A G 12: 86,421,958 H15R probably benign Het
Fbxl12 T C 9: 20,638,721 T213A probably benign Het
Fnbp4 C A 2: 90,746,771 T149K probably damaging Het
Foxj1 A T 11: 116,334,067 F158Y probably benign Het
Frrs1 A G 3: 116,878,303 T17A probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Iars2 T A 1: 185,288,091 R949* probably null Het
Ice1 T C 13: 70,604,430 E1179G probably damaging Het
Mast4 A G 13: 102,758,669 L782P probably damaging Het
Mcmdc2 A C 1: 9,934,038 K581T possibly damaging Het
Men1 A T 19: 6,336,818 D186V probably damaging Het
Morc2b T G 17: 33,136,701 N699T probably benign Het
Mrgpra2b A G 7: 47,464,717 L89P probably damaging Het
Naip1 C T 13: 100,427,187 G490E probably damaging Het
Ntm T C 9: 29,012,212 Y224C probably damaging Het
Nup88 A T 11: 70,958,340 D262E probably benign Het
Olfr1113 T C 2: 87,213,339 V149A probably benign Het
Olfr630 T A 7: 103,754,812 I258L possibly damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Oscp1 A G 4: 126,086,600 M293V probably benign Het
Pcdhgc3 C A 18: 37,807,641 A365D probably damaging Het
Pcyt2 A T 11: 120,610,722 F388I probably benign Het
Pgm2l1 C G 7: 100,253,253 A136G probably benign Het
Phf14 T G 6: 11,987,637 D638E probably benign Het
Pnpla7 A G 2: 25,050,923 K1096E probably damaging Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Rnf187 T A 11: 58,938,415 R124W probably damaging Het
RP24-77E13.10 T C 7: 7,241,902 Y11C possibly damaging Het
Sema3a T C 5: 13,400,063 Y36H probably damaging Het
Setd7 T G 3: 51,521,375 S345R probably benign Het
Sgms1 T C 19: 32,159,635 D177G probably damaging Het
Snx19 T C 9: 30,463,226 L927S possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sorl1 T C 9: 42,030,998 D977G probably damaging Het
Sptan1 C T 2: 29,980,200 R121W probably damaging Het
Srgap2 T C 1: 131,364,033 D152G probably damaging Het
Suclg2 T A 6: 95,497,719 probably null Het
Tacc2 T C 7: 130,625,304 S1240P probably benign Het
Tbc1d12 C T 19: 38,836,909 A68V probably benign Het
Tex14 G A 11: 87,474,415 D62N probably damaging Het
Thyn1 C T 9: 27,006,859 T181I probably benign Het
Trio T A 15: 27,756,542 H2056L possibly damaging Het
Ubn2 T A 6: 38,498,728 L1207Q probably damaging Het
Usp17lb T C 7: 104,840,806 S305G probably damaging Het
Vmn2r101 T A 17: 19,611,991 Y750N probably damaging Het
Wif1 G A 10: 121,096,047 S292N probably benign Het
Xpo6 T G 7: 126,128,249 Q528H possibly damaging Het
Other mutations in Hnrnpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Hnrnpl APN 7 28813373 missense probably damaging 1.00
IGL00783:Hnrnpl APN 7 28820642 missense probably benign 0.02
IGL00784:Hnrnpl APN 7 28820642 missense probably benign 0.02
IGL03248:Hnrnpl APN 7 28814080 missense probably benign 0.00
R0143:Hnrnpl UTSW 7 28814192 splice site probably benign
R1529:Hnrnpl UTSW 7 28813923 missense possibly damaging 0.74
R1567:Hnrnpl UTSW 7 28820183 missense possibly damaging 0.73
R3786:Hnrnpl UTSW 7 28811011 unclassified probably benign
R4837:Hnrnpl UTSW 7 28817337 missense probably benign 0.00
R5412:Hnrnpl UTSW 7 28811104 unclassified probably benign
R6617:Hnrnpl UTSW 7 28818584 intron probably benign
R7238:Hnrnpl UTSW 7 28813975 missense
R8336:Hnrnpl UTSW 7 28814037 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACTCCATAACCACGGTGTG -3'
(R):5'- AGCTGTCTCACTTGCACAGC -3'

Sequencing Primer
(F):5'- TGTGTGAAGGGAAGGCGCTC -3'
(R):5'- GAAGCACTGGGCCCAACTC -3'
Posted On2020-07-28