Incidental Mutation 'R0724:Plcxd3'
ID63831
Institutional Source Beutler Lab
Gene Symbol Plcxd3
Ensembl Gene ENSMUSG00000049148
Gene Namephosphatidylinositol-specific phospholipase C, X domain containing 3
Synonyms
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R0724 (G1)
Quality Score154
Status Validated
Chromosome15
Chromosomal Location4375491-4575553 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4516868 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 118 (S118N)
Ref Sequence ENSEMBL: ENSMUSP00000053553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061925] [ENSMUST00000130332]
Predicted Effect probably damaging
Transcript: ENSMUST00000061925
AA Change: S118N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053553
Gene: ENSMUSG00000049148
AA Change: S118N

DomainStartEndE-ValueType
SCOP:d2ptd__ 2 311 2e-62 SMART
PDB:1AOD|A 7 166 1e-8 PDB
Blast:PLCXc 23 148 3e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130332
Meta Mutation Damage Score 0.1339 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Plcxd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02642:Plcxd3 APN 15 4516640 missense possibly damaging 0.91
IGL02743:Plcxd3 APN 15 4574803 missense possibly damaging 0.92
IGL03230:Plcxd3 APN 15 4516790 missense probably damaging 0.99
R0599:Plcxd3 UTSW 15 4516867 missense probably damaging 0.96
R0939:Plcxd3 UTSW 15 4516862 nonsense probably null
R1536:Plcxd3 UTSW 15 4516611 splice site probably benign
R1648:Plcxd3 UTSW 15 4375809 missense probably benign
R1858:Plcxd3 UTSW 15 4516611 splice site probably benign
R2418:Plcxd3 UTSW 15 4574763 missense probably benign 0.04
R2419:Plcxd3 UTSW 15 4574763 missense probably benign 0.04
R4640:Plcxd3 UTSW 15 4517243 missense probably damaging 0.99
R4702:Plcxd3 UTSW 15 4375787 missense probably benign
R5372:Plcxd3 UTSW 15 4574788 missense probably benign
R5705:Plcxd3 UTSW 15 4517194 missense probably benign 0.43
R6302:Plcxd3 UTSW 15 4516757 missense probably damaging 1.00
R7050:Plcxd3 UTSW 15 4516718 missense probably damaging 0.96
R7283:Plcxd3 UTSW 15 4516919 missense probably damaging 0.97
R7856:Plcxd3 UTSW 15 4517099 missense probably damaging 0.98
R7939:Plcxd3 UTSW 15 4517099 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGTTCGGAACTGTAGCCAAGAAG -3'
(R):5'- ATCATCTGTCCAGGCCAGAGGAAG -3'

Sequencing Primer
(F):5'- CTGTAGCCAAGAAGTTGATGC -3'
(R):5'- TCACTTCCTGGGCAAAAATGG -3'
Posted On2013-07-30