Incidental Mutation 'R8283:Olfr630'
ID638311
Institutional Source Beutler Lab
Gene Symbol Olfr630
Ensembl Gene ENSMUSG00000050281
Gene Nameolfactory receptor 630
SynonymsMOR17-1, GA_x6K02T2PBJ9-6483085-6482126
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R8283 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location103753480-103757333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103754812 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 258 (I258L)
Ref Sequence ENSEMBL: ENSMUSP00000102493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106880]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106880
AA Change: I258L

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102493
Gene: ENSMUSG00000050281
AA Change: I258L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 305 3.7e-8 PFAM
Pfam:7tm_1 43 294 8.4e-25 PFAM
Pfam:7tm_4 144 287 9e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C T 5: 8,806,086 P65S probably damaging Het
Adcy3 A T 12: 4,200,935 R565W probably damaging Het
Arl14 A T 3: 69,222,535 N5I probably benign Het
Arl6ip6 A G 2: 53,192,238 E39G possibly damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
Boc A T 16: 44,520,437 L50Q noncoding transcript Het
Calml3 A G 13: 3,804,097 V36A probably damaging Het
Ccdc183 G A 2: 25,612,148 A238V probably damaging Het
Ccndbp1 A G 2: 121,008,584 probably benign Het
Ccr9 A G 9: 123,779,631 Y126C probably damaging Het
Cdhr1 T C 14: 37,082,780 N491S probably benign Het
Celsr2 C T 3: 108,396,455 G2429D probably damaging Het
Cts6 T C 13: 61,201,643 T84A probably damaging Het
Dcpp2 T C 17: 23,899,410 probably null Het
Drosha A G 15: 12,890,501 I945V possibly damaging Het
Dsg1b A G 18: 20,391,906 Q133R probably benign Het
Enpp1 T A 10: 24,674,656 E174D probably benign Het
Esrrb A G 12: 86,421,958 H15R probably benign Het
Fbxl12 T C 9: 20,638,721 T213A probably benign Het
Fnbp4 C A 2: 90,746,771 T149K probably damaging Het
Foxj1 A T 11: 116,334,067 F158Y probably benign Het
Frrs1 A G 3: 116,878,303 T17A probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Hnrnpl T C 7: 28,814,272 V220A Het
Iars2 T A 1: 185,288,091 R949* probably null Het
Ice1 T C 13: 70,604,430 E1179G probably damaging Het
Mast4 A G 13: 102,758,669 L782P probably damaging Het
Mcmdc2 A C 1: 9,934,038 K581T possibly damaging Het
Men1 A T 19: 6,336,818 D186V probably damaging Het
Morc2b T G 17: 33,136,701 N699T probably benign Het
Mrgpra2b A G 7: 47,464,717 L89P probably damaging Het
Naip1 C T 13: 100,427,187 G490E probably damaging Het
Ntm T C 9: 29,012,212 Y224C probably damaging Het
Nup88 A T 11: 70,958,340 D262E probably benign Het
Olfr1113 T C 2: 87,213,339 V149A probably benign Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Oscp1 A G 4: 126,086,600 M293V probably benign Het
Pcdhgc3 C A 18: 37,807,641 A365D probably damaging Het
Pcyt2 A T 11: 120,610,722 F388I probably benign Het
Pgm2l1 C G 7: 100,253,253 A136G probably benign Het
Phf14 T G 6: 11,987,637 D638E probably benign Het
Pnpla7 A G 2: 25,050,923 K1096E probably damaging Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Rnf187 T A 11: 58,938,415 R124W probably damaging Het
RP24-77E13.10 T C 7: 7,241,902 Y11C possibly damaging Het
Sema3a T C 5: 13,400,063 Y36H probably damaging Het
Setd7 T G 3: 51,521,375 S345R probably benign Het
Sgms1 T C 19: 32,159,635 D177G probably damaging Het
Snx19 T C 9: 30,463,226 L927S possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sorl1 T C 9: 42,030,998 D977G probably damaging Het
Sptan1 C T 2: 29,980,200 R121W probably damaging Het
Srgap2 T C 1: 131,364,033 D152G probably damaging Het
Suclg2 T A 6: 95,497,719 probably null Het
Tacc2 T C 7: 130,625,304 S1240P probably benign Het
Tbc1d12 C T 19: 38,836,909 A68V probably benign Het
Tex14 G A 11: 87,474,415 D62N probably damaging Het
Thyn1 C T 9: 27,006,859 T181I probably benign Het
Trio T A 15: 27,756,542 H2056L possibly damaging Het
Ubn2 T A 6: 38,498,728 L1207Q probably damaging Het
Usp17lb T C 7: 104,840,806 S305G probably damaging Het
Vmn2r101 T A 17: 19,611,991 Y750N probably damaging Het
Wif1 G A 10: 121,096,047 S292N probably benign Het
Xpo6 T G 7: 126,128,249 Q528H possibly damaging Het
Other mutations in Olfr630
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Olfr630 APN 7 103755006 missense probably damaging 1.00
IGL01111:Olfr630 APN 7 103755373 missense probably benign 0.07
IGL02456:Olfr630 APN 7 103755493 missense possibly damaging 0.94
IGL03173:Olfr630 APN 7 103754976 missense probably benign 0.00
R1104:Olfr630 UTSW 7 103754976 missense probably benign 0.00
R1507:Olfr630 UTSW 7 103755021 missense probably benign 0.00
R1695:Olfr630 UTSW 7 103754924 nonsense probably null
R1966:Olfr630 UTSW 7 103755168 missense probably damaging 1.00
R1971:Olfr630 UTSW 7 103755320 nonsense probably null
R2696:Olfr630 UTSW 7 103755528 missense probably damaging 0.96
R4943:Olfr630 UTSW 7 103755296 missense probably benign 0.12
R5622:Olfr630 UTSW 7 103755169 missense probably damaging 0.99
R6365:Olfr630 UTSW 7 103755195 missense probably benign 0.00
R7592:Olfr630 UTSW 7 103755072 missense probably damaging 1.00
R8146:Olfr630 UTSW 7 103755303 missense probably damaging 1.00
R8867:Olfr630 UTSW 7 103754686 nonsense probably null
R8875:Olfr630 UTSW 7 103755255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTGATGACATGCCTACATTG -3'
(R):5'- CTGGCTTGTGCTGACATCAG -3'

Sequencing Primer
(F):5'- GACATGCCTACATTGTAATAGAACTG -3'
(R):5'- GCTTGTGCTGACATCAGATTCAATG -3'
Posted On2020-07-28