Incidental Mutation 'R8283:Enpp1'
ID638323
Institutional Source Beutler Lab
Gene Symbol Enpp1
Ensembl Gene ENSMUSG00000037370
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 1
SynonymsPC-1, Npps, E-NPP1, Pca-1, twy, NPP1, 4833416E15Rik, Pdnp1, Pca, CD203c, Ly-41
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R8283 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location24637914-24712159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24674656 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 174 (E174D)
Ref Sequence ENSEMBL: ENSMUSP00000114273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039882] [ENSMUST00000105520] [ENSMUST00000135846]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039882
AA Change: E174D

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370
AA Change: E174D

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 358 1e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105520
AA Change: E174D

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370
AA Change: E174D

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 1.8e-87 PFAM
Endonuclease_NS 655 873 5.33e-15 SMART
NUC 656 887 3.62e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135846
AA Change: E174D

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370
AA Change: E174D

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 4.2e-91 PFAM
Endonuclease_NS 656 874 5.33e-15 SMART
NUC 657 888 3.62e-107 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the nucleoside pyrophosphatase/phosphodiesterase family of enzymes that catalyzes the hydrolysis of pyrophosphate and phosphodiester bonds in nucleotide triphosphates and oligonucleotides, respectively, to generate nucleoside 5'-monophosphates. The encoded protein is a type II transmembrane glycoprotein that negatively regulates bone mineralization. Mice harboring a nonsense mutation in this gene, termed tiptoe walking (ttw), exhibit ectopic ossification of the spinal ligaments. The encoded protein binds to the insulin receptor, inhibits downstream signaling events and induces insulin resistance and glucose tolerance. This gene is located adjacent to a paralog on chromosome 10. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele develop hyperostosis leading to ossific intervertebral fusion, peripheral joint ankylosis and tendon calcification, and display spontaneous arterial and articular cartilage calcification, and altered adipocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C T 5: 8,806,086 P65S probably damaging Het
Adcy3 A T 12: 4,200,935 R565W probably damaging Het
Arl14 A T 3: 69,222,535 N5I probably benign Het
Arl6ip6 A G 2: 53,192,238 E39G possibly damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
Boc A T 16: 44,520,437 L50Q noncoding transcript Het
Calml3 A G 13: 3,804,097 V36A probably damaging Het
Ccdc183 G A 2: 25,612,148 A238V probably damaging Het
Ccndbp1 A G 2: 121,008,584 probably benign Het
Ccr9 A G 9: 123,779,631 Y126C probably damaging Het
Cdhr1 T C 14: 37,082,780 N491S probably benign Het
Celsr2 C T 3: 108,396,455 G2429D probably damaging Het
Cts6 T C 13: 61,201,643 T84A probably damaging Het
Dcpp2 T C 17: 23,899,410 probably null Het
Drosha A G 15: 12,890,501 I945V possibly damaging Het
Dsg1b A G 18: 20,391,906 Q133R probably benign Het
Esrrb A G 12: 86,421,958 H15R probably benign Het
Fbxl12 T C 9: 20,638,721 T213A probably benign Het
Fnbp4 C A 2: 90,746,771 T149K probably damaging Het
Foxj1 A T 11: 116,334,067 F158Y probably benign Het
Frrs1 A G 3: 116,878,303 T17A probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Hnrnpl T C 7: 28,814,272 V220A Het
Iars2 T A 1: 185,288,091 R949* probably null Het
Ice1 T C 13: 70,604,430 E1179G probably damaging Het
Mast4 A G 13: 102,758,669 L782P probably damaging Het
Mcmdc2 A C 1: 9,934,038 K581T possibly damaging Het
Men1 A T 19: 6,336,818 D186V probably damaging Het
Morc2b T G 17: 33,136,701 N699T probably benign Het
Mrgpra2b A G 7: 47,464,717 L89P probably damaging Het
Naip1 C T 13: 100,427,187 G490E probably damaging Het
Ntm T C 9: 29,012,212 Y224C probably damaging Het
Nup88 A T 11: 70,958,340 D262E probably benign Het
Olfr1113 T C 2: 87,213,339 V149A probably benign Het
Olfr630 T A 7: 103,754,812 I258L possibly damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Oscp1 A G 4: 126,086,600 M293V probably benign Het
Pcdhgc3 C A 18: 37,807,641 A365D probably damaging Het
Pcyt2 A T 11: 120,610,722 F388I probably benign Het
Pgm2l1 C G 7: 100,253,253 A136G probably benign Het
Phf14 T G 6: 11,987,637 D638E probably benign Het
Pnpla7 A G 2: 25,050,923 K1096E probably damaging Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Rnf187 T A 11: 58,938,415 R124W probably damaging Het
RP24-77E13.10 T C 7: 7,241,902 Y11C possibly damaging Het
Sema3a T C 5: 13,400,063 Y36H probably damaging Het
Setd7 T G 3: 51,521,375 S345R probably benign Het
Sgms1 T C 19: 32,159,635 D177G probably damaging Het
Snx19 T C 9: 30,463,226 L927S possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sorl1 T C 9: 42,030,998 D977G probably damaging Het
Sptan1 C T 2: 29,980,200 R121W probably damaging Het
Srgap2 T C 1: 131,364,033 D152G probably damaging Het
Suclg2 T A 6: 95,497,719 probably null Het
Tacc2 T C 7: 130,625,304 S1240P probably benign Het
Tbc1d12 C T 19: 38,836,909 A68V probably benign Het
Tex14 G A 11: 87,474,415 D62N probably damaging Het
Thyn1 C T 9: 27,006,859 T181I probably benign Het
Trio T A 15: 27,756,542 H2056L possibly damaging Het
Ubn2 T A 6: 38,498,728 L1207Q probably damaging Het
Usp17lb T C 7: 104,840,806 S305G probably damaging Het
Vmn2r101 T A 17: 19,611,991 Y750N probably damaging Het
Wif1 G A 10: 121,096,047 S292N probably benign Het
Xpo6 T G 7: 126,128,249 Q528H possibly damaging Het
Other mutations in Enpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Enpp1 APN 10 24645427 missense possibly damaging 0.93
IGL00966:Enpp1 APN 10 24654031 missense probably damaging 1.00
IGL01364:Enpp1 APN 10 24664614 missense probably damaging 1.00
IGL02040:Enpp1 APN 10 24655856 missense probably damaging 1.00
IGL02143:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02631:Enpp1 APN 10 24641961 missense probably damaging 1.00
IGL02655:Enpp1 APN 10 24677974 missense probably damaging 1.00
IGL02677:Enpp1 APN 10 24679185 splice site probably benign
IGL02691:Enpp1 APN 10 24711892 missense probably damaging 0.99
IGL02966:Enpp1 APN 10 24660274 missense probably damaging 1.00
IGL03087:Enpp1 APN 10 24655881 splice site probably benign
IGL03330:Enpp1 APN 10 24664906 splice site probably benign
IGL03365:Enpp1 APN 10 24669025 missense probably damaging 1.00
IGL03377:Enpp1 APN 10 24660283 critical splice acceptor site probably null
PIT4651001:Enpp1 UTSW 10 24653950 missense probably benign 0.16
R0011:Enpp1 UTSW 10 24670002 nonsense probably null
R0201:Enpp1 UTSW 10 24653917 missense probably benign 0.00
R0496:Enpp1 UTSW 10 24672052 missense probably benign 0.18
R1228:Enpp1 UTSW 10 24645412 missense probably benign 0.30
R1536:Enpp1 UTSW 10 24641834 missense probably benign 0.27
R1927:Enpp1 UTSW 10 24654888 missense possibly damaging 0.65
R2051:Enpp1 UTSW 10 24711804 critical splice donor site probably null
R2057:Enpp1 UTSW 10 24660192 missense probably damaging 0.98
R2353:Enpp1 UTSW 10 24651341 missense probably benign 0.24
R4077:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4079:Enpp1 UTSW 10 24669007 critical splice donor site probably null
R4739:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4740:Enpp1 UTSW 10 24679248 missense probably null 0.99
R4761:Enpp1 UTSW 10 24641951 missense possibly damaging 0.94
R4822:Enpp1 UTSW 10 24661935 missense possibly damaging 0.74
R4919:Enpp1 UTSW 10 24648085 missense probably benign 0.01
R5140:Enpp1 UTSW 10 24652852 missense possibly damaging 0.51
R5302:Enpp1 UTSW 10 24651390 missense probably benign
R5421:Enpp1 UTSW 10 24669757 missense probably damaging 1.00
R5695:Enpp1 UTSW 10 24654908 missense probably damaging 0.99
R5735:Enpp1 UTSW 10 24654919 missense possibly damaging 0.92
R5789:Enpp1 UTSW 10 24647239 missense probably benign
R5942:Enpp1 UTSW 10 24676068 nonsense probably null
R6048:Enpp1 UTSW 10 24660254 missense probably damaging 1.00
R6053:Enpp1 UTSW 10 24657126 missense possibly damaging 0.93
R6305:Enpp1 UTSW 10 24641882 missense probably damaging 1.00
R6319:Enpp1 UTSW 10 24648031 missense probably damaging 1.00
R6624:Enpp1 UTSW 10 24669755 nonsense probably null
R6793:Enpp1 UTSW 10 24655825 missense probably damaging 1.00
R6936:Enpp1 UTSW 10 24651339 missense probably benign 0.30
R7255:Enpp1 UTSW 10 24645315 missense possibly damaging 0.95
R7285:Enpp1 UTSW 10 24660161 missense probably benign 0.01
R7401:Enpp1 UTSW 10 24645282 missense probably damaging 1.00
R7429:Enpp1 UTSW 10 24711950 missense probably benign 0.00
R7430:Enpp1 UTSW 10 24711950 missense probably benign 0.00
R7526:Enpp1 UTSW 10 24674410 splice site probably null
R7532:Enpp1 UTSW 10 24675987 missense probably benign 0.29
R7789:Enpp1 UTSW 10 24654083 splice site probably null
R8073:Enpp1 UTSW 10 24679244 missense possibly damaging 0.50
Z1177:Enpp1 UTSW 10 24661942 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TACCACAGTCCTCTGGAGAACC -3'
(R):5'- TTTCGAGACAGAACAGCTCTC -3'

Sequencing Primer
(F):5'- CAGCAGCAAACACAGTCTGGTG -3'
(R):5'- AGAACAGCTCTCTATATTCACGG -3'
Posted On2020-07-28