Incidental Mutation 'R0724:Emp2'
ID 63833
Institutional Source Beutler Lab
Gene Symbol Emp2
Ensembl Gene ENSMUSG00000022505
Gene Name epithelial membrane protein 2
Synonyms Xmp
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R0724 (G1)
Quality Score 181
Status Validated
Chromosome 16
Chromosomal Location 10281749-10313968 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 10284615 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 111 (C111Y)
Ref Sequence ENSEMBL: ENSMUSP00000077466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078357]
AlphaFold O88662
Predicted Effect probably benign
Transcript: ENSMUST00000078357
AA Change: C111Y

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077466
Gene: ENSMUSG00000022505
AA Change: C111Y

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 165 1.4e-60 PFAM
Pfam:Claudin_2 13 167 5.9e-10 PFAM
Meta Mutation Damage Score 0.2515 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tetraspan protein of the PMP22/EMP family. The encoded protein regulates cell membrane composition. It has been associated with various functions including endocytosis, cell signaling, cell proliferation, cell migration, cell adhesion, cell death, cholesterol homeostasis, urinary albumin excretion, and embryo implantation. It is known to negatively regulate caveolin-1, a scaffolding protein which is the main component of the caveolae plasma membrane invaginations found in most cell types. Through activation of PTK2 it positively regulates vascular endothelial growth factor A. It also modulates the function of specific integrin isomers in the plasma membrane. Up-regulation of this gene has been linked to cancer progression in multiple different tissues. Mutations in this gene have been associated with nephrotic syndrome type 10 (NPHS10). [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Emp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02333:Emp2 APN 16 10284511 missense probably damaging 1.00
IGL03085:Emp2 APN 16 10288046 splice site probably benign
IGL03354:Emp2 APN 16 10285565 missense probably damaging 0.99
P0025:Emp2 UTSW 16 10285605 splice site probably benign
R2391:Emp2 UTSW 16 10284588 missense probably damaging 0.96
R5759:Emp2 UTSW 16 10284510 missense probably damaging 1.00
R6151:Emp2 UTSW 16 10292281 missense probably damaging 1.00
R7916:Emp2 UTSW 16 10284573 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TGTACATGAGGCCGCTGATGAAAG -3'
(R):5'- GTGTCTGCAAAGCTTGAAGCCTG -3'

Sequencing Primer
(F):5'- CCGCTGATGAAAGTGAAGGC -3'
(R):5'- TTTGGCAGGCAAAAGTGC -3'
Posted On 2013-07-30