Incidental Mutation 'R0724:Emp2'
ID 63833
Institutional Source Beutler Lab
Gene Symbol Emp2
Ensembl Gene ENSMUSG00000022505
Gene Name epithelial membrane protein 2
Synonyms Xmp
MMRRC Submission 038906-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.102) question?
Stock # R0724 (G1)
Quality Score 181
Status Validated
Chromosome 16
Chromosomal Location 10099613-10131832 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 10102479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 111 (C111Y)
Ref Sequence ENSEMBL: ENSMUSP00000077466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078357]
AlphaFold O88662
Predicted Effect probably benign
Transcript: ENSMUST00000078357
AA Change: C111Y

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077466
Gene: ENSMUSG00000022505
AA Change: C111Y

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 165 1.4e-60 PFAM
Pfam:Claudin_2 13 167 5.9e-10 PFAM
Meta Mutation Damage Score 0.2515 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tetraspan protein of the PMP22/EMP family. The encoded protein regulates cell membrane composition. It has been associated with various functions including endocytosis, cell signaling, cell proliferation, cell migration, cell adhesion, cell death, cholesterol homeostasis, urinary albumin excretion, and embryo implantation. It is known to negatively regulate caveolin-1, a scaffolding protein which is the main component of the caveolae plasma membrane invaginations found in most cell types. Through activation of PTK2 it positively regulates vascular endothelial growth factor A. It also modulates the function of specific integrin isomers in the plasma membrane. Up-regulation of this gene has been linked to cancer progression in multiple different tissues. Mutations in this gene have been associated with nephrotic syndrome type 10 (NPHS10). [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 144,981,573 (GRCm39) E136G probably benign Het
Adgre4 T A 17: 56,159,281 (GRCm39) S655R probably benign Het
Ak7 T A 12: 105,676,513 (GRCm39) V71E probably benign Het
Ank2 C T 3: 126,755,986 (GRCm39) R1077H probably damaging Het
Anxa3 A G 5: 96,976,607 (GRCm39) T198A possibly damaging Het
Atp1a1 A T 3: 101,499,755 (GRCm39) I109N possibly damaging Het
Camta1 A G 4: 151,162,349 (GRCm39) I119T probably damaging Het
Carm1 A G 9: 21,498,670 (GRCm39) Y504C probably damaging Het
Casp1 C T 9: 5,303,077 (GRCm39) P177L probably benign Het
Ccdc122 C A 14: 77,329,517 (GRCm39) probably benign Het
Ces1a A G 8: 93,766,141 (GRCm39) S158P probably damaging Het
Ces3a T A 8: 105,776,827 (GRCm39) D103E possibly damaging Het
Clstn1 A C 4: 149,728,081 (GRCm39) D583A possibly damaging Het
Corin A G 5: 72,490,138 (GRCm39) probably benign Het
Cryba1 T C 11: 77,610,283 (GRCm39) D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 (GRCm39) probably null Het
Dis3l T C 9: 64,214,408 (GRCm39) T1027A possibly damaging Het
Dop1b A G 16: 93,559,213 (GRCm39) E653G probably benign Het
Dst A G 1: 34,227,758 (GRCm39) I1459V probably benign Het
Dyrk3 T C 1: 131,057,877 (GRCm39) T64A probably benign Het
Enam A G 5: 88,649,853 (GRCm39) Y454C probably damaging Het
Fbn1 A T 2: 125,193,984 (GRCm39) C1328S probably benign Het
Gata3 T C 2: 9,879,386 (GRCm39) T197A probably benign Het
Gm1043 A G 5: 37,344,573 (GRCm39) T212A probably damaging Het
H2-Eb1 T C 17: 34,534,006 (GRCm39) probably benign Het
Hand1 T C 11: 57,722,506 (GRCm39) H36R probably damaging Het
Hmgcs2 C A 3: 98,204,317 (GRCm39) Y239* probably null Het
Hoxc12 A G 15: 102,845,490 (GRCm39) Y68C probably damaging Het
Inpp5a A G 7: 139,096,579 (GRCm39) I143V probably benign Het
Klhdc2 C A 12: 69,343,822 (GRCm39) F18L probably benign Het
Kpnb1 T C 11: 97,069,130 (GRCm39) Y251C probably damaging Het
Lrch4 A T 5: 137,635,570 (GRCm39) N315I probably damaging Het
Map3k10 A C 7: 27,367,780 (GRCm39) V286G probably damaging Het
Myo7b G A 18: 32,138,602 (GRCm39) probably benign Het
Nlrp2 G T 7: 5,322,221 (GRCm39) L809I probably damaging Het
Oacyl T C 18: 65,870,896 (GRCm39) probably benign Het
Or4q3 A G 14: 50,583,374 (GRCm39) V175A possibly damaging Het
Paxbp1 T A 16: 90,833,424 (GRCm39) D270V probably damaging Het
Pdia3 G A 2: 121,262,858 (GRCm39) G275S probably damaging Het
Pira13 T C 7: 3,819,871 (GRCm39) N564S possibly damaging Het
Plcb3 G A 19: 6,940,760 (GRCm39) R359C probably damaging Het
Plcxd3 G A 15: 4,546,350 (GRCm39) S118N probably damaging Het
Ptpn14 T C 1: 189,583,144 (GRCm39) S664P possibly damaging Het
Sirt1 T C 10: 63,159,752 (GRCm39) I443V possibly damaging Het
Slc7a8 G A 14: 54,972,643 (GRCm39) probably benign Het
Smim14 A G 5: 65,610,682 (GRCm39) probably benign Het
Sost C T 11: 101,857,744 (GRCm39) C19Y probably benign Het
Tcaf1 G T 6: 42,652,301 (GRCm39) A727E probably damaging Het
Thoc1 T C 18: 9,963,829 (GRCm39) L144P probably damaging Het
Tmem132b A T 5: 125,860,485 (GRCm39) T577S possibly damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tshr T C 12: 91,505,060 (GRCm39) F666S probably damaging Het
Wdr1 A G 5: 38,698,205 (GRCm39) V192A possibly damaging Het
Zfp697 T C 3: 98,335,482 (GRCm39) W416R probably damaging Het
Other mutations in Emp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02333:Emp2 APN 16 10,102,375 (GRCm39) missense probably damaging 1.00
IGL03085:Emp2 APN 16 10,105,910 (GRCm39) splice site probably benign
IGL03354:Emp2 APN 16 10,103,429 (GRCm39) missense probably damaging 0.99
P0025:Emp2 UTSW 16 10,103,469 (GRCm39) splice site probably benign
R2391:Emp2 UTSW 16 10,102,452 (GRCm39) missense probably damaging 0.96
R5759:Emp2 UTSW 16 10,102,374 (GRCm39) missense probably damaging 1.00
R6151:Emp2 UTSW 16 10,110,145 (GRCm39) missense probably damaging 1.00
R7916:Emp2 UTSW 16 10,102,437 (GRCm39) missense possibly damaging 0.58
R9619:Emp2 UTSW 16 10,102,420 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTACATGAGGCCGCTGATGAAAG -3'
(R):5'- GTGTCTGCAAAGCTTGAAGCCTG -3'

Sequencing Primer
(F):5'- CCGCTGATGAAAGTGAAGGC -3'
(R):5'- TTTGGCAGGCAAAAGTGC -3'
Posted On 2013-07-30