Incidental Mutation 'R8283:Gm10110'
ID638338
Institutional Source Beutler Lab
Gene Symbol Gm10110
Ensembl Gene ENSMUSG00000062093
Gene Namepredicted gene 10110
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R8283 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location89896223-89898466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89898241 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 76 (V76M)
Ref Sequence ENSEMBL: ENSMUSP00000079967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081204]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000081204
AA Change: V76M
SMART Domains Protein: ENSMUSP00000079967
Gene: ENSMUSG00000062093
AA Change: V76M

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 1.92e-25 SMART
low complexity region 478 493 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
PolyA 534 597 4.49e-41 SMART
Meta Mutation Damage Score 0.1229 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C T 5: 8,806,086 P65S probably damaging Het
Adcy3 A T 12: 4,200,935 R565W probably damaging Het
Arl14 A T 3: 69,222,535 N5I probably benign Het
Arl6ip6 A G 2: 53,192,238 E39G possibly damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
Axl C T 7: 25,763,954 D633N probably benign Het
Boc A T 16: 44,520,437 L50Q noncoding transcript Het
Calml3 A G 13: 3,804,097 V36A probably damaging Het
Ccdc183 G A 2: 25,612,148 A238V probably damaging Het
Ccndbp1 A G 2: 121,008,584 probably benign Het
Ccr9 A G 9: 123,779,631 Y126C probably damaging Het
Cdhr1 T C 14: 37,082,780 N491S probably benign Het
Celsr2 C T 3: 108,396,455 G2429D probably damaging Het
Cts6 T C 13: 61,201,643 T84A probably damaging Het
Dcpp2 T C 17: 23,899,410 probably null Het
Drosha A G 15: 12,890,501 I945V possibly damaging Het
Dsg1b A G 18: 20,391,906 Q133R probably benign Het
Enpp1 T A 10: 24,674,656 E174D probably benign Het
Esrrb A G 12: 86,421,958 H15R probably benign Het
Fbxl12 T C 9: 20,638,721 T213A probably benign Het
Fnbp4 C A 2: 90,746,771 T149K probably damaging Het
Foxj1 A T 11: 116,334,067 F158Y probably benign Het
Frrs1 A G 3: 116,878,303 T17A probably benign Het
Hnrnpl T C 7: 28,814,272 V220A Het
Iars2 T A 1: 185,288,091 R949* probably null Het
Ice1 T C 13: 70,604,430 E1179G probably damaging Het
Mast4 A G 13: 102,758,669 L782P probably damaging Het
Mcmdc2 A C 1: 9,934,038 K581T possibly damaging Het
Men1 A T 19: 6,336,818 D186V probably damaging Het
Morc2b T G 17: 33,136,701 N699T probably benign Het
Mrgpra2b A G 7: 47,464,717 L89P probably damaging Het
Naip1 C T 13: 100,427,187 G490E probably damaging Het
Ntm T C 9: 29,012,212 Y224C probably damaging Het
Nup88 A T 11: 70,958,340 D262E probably benign Het
Olfr1113 T C 2: 87,213,339 V149A probably benign Het
Olfr630 T A 7: 103,754,812 I258L possibly damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Oscp1 A G 4: 126,086,600 M293V probably benign Het
Pcdhgc3 C A 18: 37,807,641 A365D probably damaging Het
Pcyt2 A T 11: 120,610,722 F388I probably benign Het
Pgm2l1 C G 7: 100,253,253 A136G probably benign Het
Phf14 T G 6: 11,987,637 D638E probably benign Het
Pnpla7 A G 2: 25,050,923 K1096E probably damaging Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Rnf187 T A 11: 58,938,415 R124W probably damaging Het
RP24-77E13.10 T C 7: 7,241,902 Y11C possibly damaging Het
Sema3a T C 5: 13,400,063 Y36H probably damaging Het
Setd7 T G 3: 51,521,375 S345R probably benign Het
Sgms1 T C 19: 32,159,635 D177G probably damaging Het
Snx19 T C 9: 30,463,226 L927S possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Sorl1 T C 9: 42,030,998 D977G probably damaging Het
Sptan1 C T 2: 29,980,200 R121W probably damaging Het
Srgap2 T C 1: 131,364,033 D152G probably damaging Het
Suclg2 T A 6: 95,497,719 probably null Het
Tacc2 T C 7: 130,625,304 S1240P probably benign Het
Tbc1d12 C T 19: 38,836,909 A68V probably benign Het
Tex14 G A 11: 87,474,415 D62N probably damaging Het
Thyn1 C T 9: 27,006,859 T181I probably benign Het
Trio T A 15: 27,756,542 H2056L possibly damaging Het
Ubn2 T A 6: 38,498,728 L1207Q probably damaging Het
Usp17lb T C 7: 104,840,806 S305G probably damaging Het
Vmn2r101 T A 17: 19,611,991 Y750N probably damaging Het
Wif1 G A 10: 121,096,047 S292N probably benign Het
Xpo6 T G 7: 126,128,249 Q528H possibly damaging Het
Other mutations in Gm10110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Gm10110 APN 14 89898241 exon noncoding transcript
IGL02308:Gm10110 APN 14 89897595 exon noncoding transcript
IGL02977:Gm10110 APN 14 89897332 exon noncoding transcript
IGL03230:Gm10110 APN 14 89898297 exon noncoding transcript
R0966:Gm10110 UTSW 14 89898119 exon noncoding transcript
R1466:Gm10110 UTSW 14 89898075 exon noncoding transcript
R1466:Gm10110 UTSW 14 89898075 exon noncoding transcript
R1640:Gm10110 UTSW 14 89898243 exon noncoding transcript
R1762:Gm10110 UTSW 14 89897389 exon noncoding transcript
R1839:Gm10110 UTSW 14 89897836 exon noncoding transcript
R2679:Gm10110 UTSW 14 89897416 exon noncoding transcript
R3907:Gm10110 UTSW 14 89898147 exon noncoding transcript
R4512:Gm10110 UTSW 14 89897715 exon noncoding transcript
R4513:Gm10110 UTSW 14 89897715 exon noncoding transcript
R4590:Gm10110 UTSW 14 89897546 exon noncoding transcript
R4877:Gm10110 UTSW 14 89897349 exon noncoding transcript
R5771:Gm10110 UTSW 14 89897239 exon noncoding transcript
R6333:Gm10110 UTSW 14 89898297 exon noncoding transcript
R6341:Gm10110 UTSW 14 89896708 exon noncoding transcript
R8235:Gm10110 UTSW 14 89898241 missense noncoding transcript
R8236:Gm10110 UTSW 14 89898241 missense noncoding transcript
R8237:Gm10110 UTSW 14 89898241 missense noncoding transcript
R8281:Gm10110 UTSW 14 89898241 missense noncoding transcript
R8282:Gm10110 UTSW 14 89898241 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- CCTCTTGGGTCTCGAAGTGAAC -3'
(R):5'- GATTTGCACTCGGACGTCAC -3'

Sequencing Primer
(F):5'- AGCATAGCCCTTAGAGCCGTTC -3'
(R):5'- TCACCGAAGCCATGCTGTATG -3'
Posted On2020-07-28