Mutagenetix > Incidental Mutation

Incidental Mutation 'R8283:Trio'

638340

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

067706-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8283 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

27730737-28025934 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 27756628 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 2056 (H2056L)

Ref Sequence

ENSEMBL: ENSMUSP00000087714 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090247
AA Change: H2056L

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: H2056L

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	C	T	5: 8,856,086 (GRCm39)	P65S	probably damaging	Het
Adcy3	A	T	12: 4,250,935 (GRCm39)	R565W	probably damaging	Het
Arl14	A	T	3: 69,129,868 (GRCm39)	N5I	probably benign	Het
Arl6ip6	A	G	2: 53,082,250 (GRCm39)	E39G	possibly damaging	Het
Aven	C	T	2: 112,390,120 (GRCm39)	R8W	probably benign	Het
Axl	C	T	7: 25,463,379 (GRCm39)	D633N	probably benign	Het
Boc	A	T	16: 44,340,800 (GRCm39)	L50Q	noncoding transcript	Het
Calml3	A	G	13: 3,854,097 (GRCm39)	V36A	probably damaging	Het
Ccdc183	G	A	2: 25,502,160 (GRCm39)	A238V	probably damaging	Het
Ccndbp1	A	G	2: 120,839,065 (GRCm39)		probably benign	Het
Ccr9	A	G	9: 123,608,696 (GRCm39)	Y126C	probably damaging	Het
Cdhr1	T	C	14: 36,804,737 (GRCm39)	N491S	probably benign	Het
Celsr2	C	T	3: 108,303,771 (GRCm39)	G2429D	probably damaging	Het
Cts6	T	C	13: 61,349,457 (GRCm39)	T84A	probably damaging	Het
Dcpp2	T	C	17: 24,118,384 (GRCm39)		probably null	Het
Drosha	A	G	15: 12,890,587 (GRCm39)	I945V	possibly damaging	Het
Dsg1b	A	G	18: 20,524,963 (GRCm39)	Q133R	probably benign	Het
Enpp1	T	A	10: 24,550,554 (GRCm39)	E174D	probably benign	Het
Esrrb	A	G	12: 86,468,732 (GRCm39)	H15R	probably benign	Het
Fbxl12	T	C	9: 20,550,017 (GRCm39)	T213A	probably benign	Het
Fnbp4	C	A	2: 90,577,115 (GRCm39)	T149K	probably damaging	Het
Foxj1	A	T	11: 116,224,893 (GRCm39)	F158Y	probably benign	Het
Frrs1	A	G	3: 116,671,952 (GRCm39)	T17A	probably benign	Het
Gm10110	C	T	14: 90,135,677 (GRCm39)	V76M	noncoding transcript	Het
Gm45844	T	C	7: 7,244,901 (GRCm39)	Y11C	possibly damaging	Het
Hnrnpl	T	C	7: 28,513,697 (GRCm39)	V220A		Het
Iars2	T	A	1: 185,020,288 (GRCm39)	R949*	probably null	Het
Ice1	T	C	13: 70,752,549 (GRCm39)	E1179G	probably damaging	Het
Mast4	A	G	13: 102,895,177 (GRCm39)	L782P	probably damaging	Het
Mcmdc2	A	C	1: 10,004,263 (GRCm39)	K581T	possibly damaging	Het
Men1	A	T	19: 6,386,848 (GRCm39)	D186V	probably damaging	Het
Morc2b	T	G	17: 33,355,675 (GRCm39)	N699T	probably benign	Het
Mrgpra2b	A	G	7: 47,114,465 (GRCm39)	L89P	probably damaging	Het
Naip1	C	T	13: 100,563,695 (GRCm39)	G490E	probably damaging	Het
Ntm	T	C	9: 28,923,508 (GRCm39)	Y224C	probably damaging	Het
Nup88	A	T	11: 70,849,166 (GRCm39)	D262E	probably benign	Het
Or10ag52	T	C	2: 87,043,683 (GRCm39)	V149A	probably benign	Het
Or51l4	T	A	7: 103,404,019 (GRCm39)	I258L	possibly damaging	Het
Or8b54	G	A	9: 38,686,577 (GRCm39)	V9M	noncoding transcript	Het
Oscp1	A	G	4: 125,980,393 (GRCm39)	M293V	probably benign	Het
Pcdhgc3	C	A	18: 37,940,694 (GRCm39)	A365D	probably damaging	Het
Pcyt2	A	T	11: 120,501,548 (GRCm39)	F388I	probably benign	Het
Pgm2l1	C	G	7: 99,902,460 (GRCm39)	A136G	probably benign	Het
Phf14	T	G	6: 11,987,636 (GRCm39)	D638E	probably benign	Het
Pnpla7	A	G	2: 24,940,935 (GRCm39)	K1096E	probably damaging	Het
Prkcb	T	A	7: 122,199,948 (GRCm39)	C586*	probably null	Het
Rnf187	T	A	11: 58,829,241 (GRCm39)	R124W	probably damaging	Het
Sema3a	T	C	5: 13,450,030 (GRCm39)	Y36H	probably damaging	Het
Setd7	T	G	3: 51,428,796 (GRCm39)	S345R	probably benign	Het
Sgms1	T	C	19: 32,137,035 (GRCm39)	D177G	probably damaging	Het
Snx19	T	C	9: 30,374,522 (GRCm39)	L927S	possibly damaging	Het
Sorbs1	G	C	19: 40,365,244 (GRCm39)	R180G	probably benign	Het
Sorl1	T	C	9: 41,942,294 (GRCm39)	D977G	probably damaging	Het
Sptan1	C	T	2: 29,870,212 (GRCm39)	R121W	probably damaging	Het
Srgap2	T	C	1: 131,291,771 (GRCm39)	D152G	probably damaging	Het
Suclg2	T	A	6: 95,474,700 (GRCm39)		probably null	Het
Tacc2	T	C	7: 130,227,034 (GRCm39)	S1240P	probably benign	Het
Tbc1d12	C	T	19: 38,825,353 (GRCm39)	A68V	probably benign	Het
Tex14	G	A	11: 87,365,241 (GRCm39)	D62N	probably damaging	Het
Thyn1	C	T	9: 26,918,155 (GRCm39)	T181I	probably benign	Het
Ubn2	T	A	6: 38,475,663 (GRCm39)	L1207Q	probably damaging	Het
Usp17lb	T	C	7: 104,490,013 (GRCm39)	S305G	probably damaging	Het
Vmn2r101	T	A	17: 19,832,253 (GRCm39)	Y750N	probably damaging	Het
Wif1	G	A	10: 120,931,952 (GRCm39)	S292N	probably benign	Het
Xpo6	T	G	7: 125,727,421 (GRCm39)	Q528H	possibly damaging	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27,912,829 (GRCm39)	splice site	probably benign
IGL01011:Trio	APN	15	27,736,575 (GRCm39)	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27,773,093 (GRCm39)	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27,818,253 (GRCm39)	splice site	probably benign
IGL01147:Trio	APN	15	27,881,406 (GRCm39)	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27,749,867 (GRCm39)	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27,905,409 (GRCm39)	missense	probably benign	0.42
IGL01352:Trio	APN	15	27,901,315 (GRCm39)	missense	probably benign	0.01
IGL01366:Trio	APN	15	27,732,954 (GRCm39)	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27,838,861 (GRCm39)	splice site	probably benign
IGL01454:Trio	APN	15	27,833,071 (GRCm39)	missense	probably benign	0.32
IGL01695:Trio	APN	15	27,773,087 (GRCm39)	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27,764,112 (GRCm39)	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27,846,896 (GRCm39)	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27,741,119 (GRCm39)	missense	probably benign	0.12
IGL01991:Trio	APN	15	27,871,360 (GRCm39)	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27,744,244 (GRCm39)	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27,744,139 (GRCm39)	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27,902,647 (GRCm39)	missense	probably benign	0.24
IGL02304:Trio	APN	15	27,735,522 (GRCm39)	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27,847,476 (GRCm39)	nonsense	probably null
IGL02508:Trio	APN	15	27,818,190 (GRCm39)	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27,845,016 (GRCm39)	splice site	probably benign
IGL02617:Trio	APN	15	27,841,935 (GRCm39)	splice site	probably benign
IGL02675:Trio	APN	15	27,768,125 (GRCm39)	unclassified	probably benign
IGL02817:Trio	APN	15	27,902,967 (GRCm39)	missense	probably benign	0.01
IGL02993:Trio	APN	15	27,830,325 (GRCm39)	splice site	probably benign
IGL03007:Trio	APN	15	27,902,828 (GRCm39)	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27,832,097 (GRCm39)	splice site	probably benign
IGL03225:Trio	APN	15	27,902,781 (GRCm39)	missense	probably benign	0.30
R0063:Trio	UTSW	15	27,881,523 (GRCm39)	splice site	probably benign
R0063:Trio	UTSW	15	27,881,523 (GRCm39)	splice site	probably benign
R0302:Trio	UTSW	15	27,902,603 (GRCm39)	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27,767,993 (GRCm39)	missense	probably benign	0.00
R0506:Trio	UTSW	15	27,855,049 (GRCm39)	missense	probably benign	0.12
R0564:Trio	UTSW	15	27,805,908 (GRCm39)	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27,831,485 (GRCm39)	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27,732,980 (GRCm39)	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27,741,336 (GRCm39)	critical splice donor site	probably null
R1018:Trio	UTSW	15	27,871,257 (GRCm39)	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27,898,000 (GRCm39)	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27,753,890 (GRCm39)	splice site	probably benign
R1488:Trio	UTSW	15	27,741,053 (GRCm39)	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27,732,726 (GRCm39)	missense	probably benign	0.28
R1531:Trio	UTSW	15	27,833,071 (GRCm39)	missense	probably benign	0.32
R1640:Trio	UTSW	15	27,833,130 (GRCm39)	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27,758,433 (GRCm39)	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27,744,232 (GRCm39)	splice site	probably null
R1780:Trio	UTSW	15	27,744,124 (GRCm39)	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27,841,842 (GRCm39)	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27,748,426 (GRCm39)	missense	probably benign
R1817:Trio	UTSW	15	27,742,581 (GRCm39)	nonsense	probably null
R1853:Trio	UTSW	15	27,756,622 (GRCm39)	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27,742,466 (GRCm39)	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27,833,142 (GRCm39)	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27,732,977 (GRCm39)	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27,774,013 (GRCm39)	missense	probably damaging	1.00
R2025:Trio	UTSW	15	27,744,223 (GRCm39)	missense	probably damaging	0.99
R2050:Trio	UTSW	15	27,852,031 (GRCm39)	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27,824,061 (GRCm39)	splice site	probably null
R2913:Trio	UTSW	15	27,854,998 (GRCm39)	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27,805,862 (GRCm39)	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27,748,177 (GRCm39)	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27,748,177 (GRCm39)	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27,833,156 (GRCm39)	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27,744,187 (GRCm39)	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27,749,883 (GRCm39)	nonsense	probably null
R4370:Trio	UTSW	15	27,748,423 (GRCm39)	nonsense	probably null
R4547:Trio	UTSW	15	27,819,068 (GRCm39)	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27,773,084 (GRCm39)	small deletion	probably benign
R4620:Trio	UTSW	15	27,871,257 (GRCm39)	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27,752,875 (GRCm39)	splice site	probably null
R4764:Trio	UTSW	15	27,732,624 (GRCm39)	nonsense	probably null
R4775:Trio	UTSW	15	27,881,428 (GRCm39)	nonsense	probably null
R4942:Trio	UTSW	15	27,752,811 (GRCm39)	missense	probably benign	0.21
R5004:Trio	UTSW	15	27,755,264 (GRCm39)	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27,754,115 (GRCm39)	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27,902,686 (GRCm39)	missense	probably benign	0.00
R5186:Trio	UTSW	15	27,898,077 (GRCm39)	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27,748,372 (GRCm39)	missense	probably benign	0.02
R5344:Trio	UTSW	15	27,735,618 (GRCm39)	missense	probably benign	0.12
R5407:Trio	UTSW	15	27,844,892 (GRCm39)	splice site	probably null
R5442:Trio	UTSW	15	27,856,280 (GRCm39)	missense	probably benign	0.04
R5617:Trio	UTSW	15	27,902,834 (GRCm39)	missense	probably benign
R5778:Trio	UTSW	15	27,856,250 (GRCm39)	missense	probably benign	0.33
R5986:Trio	UTSW	15	27,852,019 (GRCm39)	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27,891,545 (GRCm39)	missense	probably benign	0.10
R6011:Trio	UTSW	15	27,735,631 (GRCm39)	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27,891,465 (GRCm39)	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27,818,157 (GRCm39)	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27,744,038 (GRCm39)	critical splice donor site	probably null
R6387:Trio	UTSW	15	27,752,825 (GRCm39)	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27,902,997 (GRCm39)	missense	probably benign	0.02
R6478:Trio	UTSW	15	27,856,193 (GRCm39)	missense	probably benign	0.01
R6528:Trio	UTSW	15	27,805,956 (GRCm39)	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27,855,082 (GRCm39)	missense	probably benign	0.00
R6825:Trio	UTSW	15	27,889,394 (GRCm39)	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27,919,374 (GRCm39)	unclassified	probably benign
R6945:Trio	UTSW	15	27,824,176 (GRCm39)	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27,805,740 (GRCm39)	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27,832,137 (GRCm39)	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27,749,885 (GRCm39)	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27,898,086 (GRCm39)	missense	unknown
R7094:Trio	UTSW	15	27,891,534 (GRCm39)	missense	unknown
R7123:Trio	UTSW	15	27,742,399 (GRCm39)	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27,742,399 (GRCm39)	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27,871,273 (GRCm39)	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27,828,437 (GRCm39)	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27,871,375 (GRCm39)	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27,732,962 (GRCm39)	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27,856,193 (GRCm39)	missense	probably benign	0.01
R7451:Trio	UTSW	15	27,747,999 (GRCm39)	missense	probably benign	0.07
R7558:Trio	UTSW	15	27,831,480 (GRCm39)	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27,855,025 (GRCm39)	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27,749,912 (GRCm39)	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27,736,531 (GRCm39)	critical splice donor site	probably null
R7609:Trio	UTSW	15	27,912,728 (GRCm39)	missense	unknown
R7767:Trio	UTSW	15	27,889,504 (GRCm39)	missense	unknown
R7784:Trio	UTSW	15	27,764,080 (GRCm39)	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27,749,952 (GRCm39)	missense	probably benign	0.35
R7833:Trio	UTSW	15	27,774,172 (GRCm39)	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27,805,770 (GRCm39)	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27,852,010 (GRCm39)	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27,773,021 (GRCm39)	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27,749,952 (GRCm39)	missense	probably benign	0.35
R8050:Trio	UTSW	15	27,891,540 (GRCm39)	missense	unknown
R8217:Trio	UTSW	15	27,819,055 (GRCm39)	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27,902,996 (GRCm39)	missense	unknown
R8300:Trio	UTSW	15	27,855,108 (GRCm39)	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27,881,412 (GRCm39)	missense	possibly damaging	0.90
R8477:Trio	UTSW	15	27,774,038 (GRCm39)	missense	possibly damaging	0.83
R8479:Trio	UTSW	15	27,901,286 (GRCm39)	missense	probably benign	0.25
R8682:Trio	UTSW	15	27,905,278 (GRCm39)	missense	unknown
R8688:Trio	UTSW	15	27,748,324 (GRCm39)	missense	possibly damaging	0.61
R8708:Trio	UTSW	15	27,732,632 (GRCm39)	missense	probably damaging	0.99
R8709:Trio	UTSW	15	27,919,323 (GRCm39)	missense	unknown
R8713:Trio	UTSW	15	27,744,037 (GRCm39)	critical splice donor site	probably benign
R8798:Trio	UTSW	15	27,851,923 (GRCm39)	missense	possibly damaging	0.92
R8812:Trio	UTSW	15	27,905,311 (GRCm39)	missense	unknown
R8816:Trio	UTSW	15	27,741,357 (GRCm39)	missense	probably damaging	0.96
R8828:Trio	UTSW	15	27,741,150 (GRCm39)	missense	possibly damaging	0.93
R8987:Trio	UTSW	15	27,732,773 (GRCm39)	missense	probably benign	0.23
R9051:Trio	UTSW	15	27,732,770 (GRCm39)	missense	possibly damaging	0.78
R9069:Trio	UTSW	15	27,852,097 (GRCm39)	missense	possibly damaging	0.83
R9075:Trio	UTSW	15	27,774,022 (GRCm39)	nonsense	probably null
R9079:Trio	UTSW	15	27,733,023 (GRCm39)	missense	possibly damaging	0.52
R9139:Trio	UTSW	15	27,749,922 (GRCm39)	nonsense	probably null
R9494:Trio	UTSW	15	27,846,843 (GRCm39)	missense	probably benign	0.00
R9680:Trio	UTSW	15	27,744,158 (GRCm39)	missense	possibly damaging	0.93
R9720:Trio	UTSW	15	27,847,495 (GRCm39)	missense	probably benign	0.00
R9726:Trio	UTSW	15	27,912,752 (GRCm39)	missense	unknown
X0024:Trio	UTSW	15	27,765,812 (GRCm39)	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27,771,473 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCAAAGCAAGCTTTAGGAACC -3'
(R):5'- CTGTTTCAGAGCCTCAGAGC -3'

Sequencing Primer
(F):5'- AGCAAGCTTTAGGAACCTCATCTCTG -3'
(R):5'- CCAGGGTGGCCAAATGC -3'

Posted On

2020-07-28