Incidental Mutation 'R8284:Tlk1'
ID638358
Institutional Source Beutler Lab
Gene Symbol Tlk1
Ensembl Gene ENSMUSG00000041997
Gene Nametousled-like kinase 1
Synonyms4930545J15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8284 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location70712407-70825728 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70714021 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 757 (T757A)
Ref Sequence ENSEMBL: ENSMUSP00000035961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038584] [ENSMUST00000133432]
Predicted Effect probably benign
Transcript: ENSMUST00000038584
AA Change: T757A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035961
Gene: ENSMUSG00000041997
AA Change: T757A

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
low complexity region 68 85 N/A INTRINSIC
low complexity region 170 192 N/A INTRINSIC
coiled coil region 248 277 N/A INTRINSIC
coiled coil region 403 441 N/A INTRINSIC
S_TKc 456 734 4.41e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133432
SMART Domains Protein: ENSMUSP00000121549
Gene: ENSMUSG00000014959

DomainStartEndE-ValueType
PDZ 5 75 8.14e-1 SMART
internal_repeat_1 107 196 1.1e-15 PROSPERO
low complexity region 236 252 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase that may be involved in the regulation of chromatin assembly. The encoded protein is only active when it is phosphorylated, and this phosphorylation is cell cycle-dependent, with the maximal activity of this protein coming during S phase. The catalytic activity of this protein is diminished by DNA damage and by blockage of DNA replication. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T C 10: 61,198,659 Y1147C possibly damaging Het
Adgrf5 T A 17: 43,455,270 S1328T unknown Het
Aff4 A G 11: 53,404,552 K860E probably damaging Het
Aox1 A C 1: 58,076,091 H745P probably damaging Het
Bpifc T C 10: 86,000,549 T31A probably benign Het
C3 C A 17: 57,223,938 V388L probably benign Het
Celsr3 G T 9: 108,846,413 M2874I probably damaging Het
Cnga4 T A 7: 105,408,032 D550E probably benign Het
Dhx8 A G 11: 101,757,629 T918A probably damaging Het
Dnah14 A C 1: 181,773,811 E3670A probably benign Het
Fbxo31 T C 8: 121,560,442 I131V probably benign Het
Ftcd T C 10: 76,578,059 V99A probably benign Het
Gucy2e A G 11: 69,232,351 V471A probably benign Het
H60b T A 10: 22,287,072 L182Q probably benign Het
Hbp1 G A 12: 31,937,626 H188Y probably damaging Het
Itga4 C T 2: 79,321,439 T862I probably benign Het
Kcnmb4 T A 10: 116,418,253 K206N probably damaging Het
Klra4 A G 6: 130,065,280 F8S possibly damaging Het
Mrpl2 C A 17: 46,647,509 Y72* probably null Het
Nup214 T C 2: 31,996,446 S607P possibly damaging Het
Oas1d C T 5: 120,919,158 R276* probably null Het
Olfr10 A G 11: 49,318,175 T210A probably benign Het
Olfr103 C T 17: 37,336,696 V179I probably benign Het
Olfr31 T A 14: 14,329,011 L300Q possibly damaging Het
Olfr355 T A 2: 36,928,006 Y36F probably damaging Het
Pex13 A G 11: 23,655,685 S182P possibly damaging Het
Piwil4 G T 9: 14,727,478 N297K probably benign Het
Plxna4 T C 6: 32,152,854 T1845A probably benign Het
Pml T C 9: 58,229,360 N579D probably benign Het
Ppl A G 16: 5,132,337 S3P probably damaging Het
Pramef25 G T 4: 143,950,125 D136E possibly damaging Het
Prss54 G A 8: 95,559,366 Q360* probably null Het
Ralgps2 A G 1: 156,828,148 I402T probably benign Het
Rnf213 T A 11: 119,428,083 D1123E Het
Sdha A T 13: 74,331,297 probably null Het
Senp8 G A 9: 59,737,531 T114I Het
Setx C T 2: 29,145,336 T611I possibly damaging Het
Shc1 T G 3: 89,421,908 S20A possibly damaging Het
Slc15a1 T C 14: 121,489,863 I98V probably benign Het
Snrk A G 9: 122,160,472 E294G probably damaging Het
Sox18 G A 2: 181,670,958 P127S probably damaging Het
Spta1 A G 1: 174,179,821 T206A probably benign Het
Tcfl5 A G 2: 180,638,537 S358P probably benign Het
Tecta T A 9: 42,378,029 L413F possibly damaging Het
Tmem232 T A 17: 65,402,995 I433F probably damaging Het
Top1mt T A 15: 75,667,863 K300* probably null Het
Trbv20 C T 6: 41,188,848 A69V probably damaging Het
Trim12a A T 7: 104,306,075 L147Q probably damaging Het
Tuba8 G A 6: 121,222,777 S140N probably damaging Het
Vcan A T 13: 89,704,335 N835K possibly damaging Het
Xrcc1 G A 7: 24,572,278 R562H probably damaging Het
Yipf7 C T 5: 69,517,196 G202D probably benign Het
Ythdc1 T G 5: 86,816,466 S45A probably benign Het
Other mutations in Tlk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Tlk1 APN 2 70745516 missense probably damaging 1.00
IGL01087:Tlk1 APN 2 70752316 missense possibly damaging 0.64
IGL01514:Tlk1 APN 2 70752266 missense probably benign 0.00
IGL02976:Tlk1 APN 2 70721591 nonsense probably null
IGL03024:Tlk1 APN 2 70746036 nonsense probably null
Aku-aku UTSW 2 70738445 missense probably damaging 0.98
Heyerdahl UTSW 2 70738426 nonsense probably null
K3955:Tlk1 UTSW 2 70721701 missense possibly damaging 0.85
R0107:Tlk1 UTSW 2 70713989 makesense probably null
R0226:Tlk1 UTSW 2 70714169 unclassified probably benign
R0332:Tlk1 UTSW 2 70745565 synonymous probably null
R0601:Tlk1 UTSW 2 70714158 missense probably benign 0.44
R1739:Tlk1 UTSW 2 70721077 missense probably damaging 1.00
R2080:Tlk1 UTSW 2 70738445 missense probably damaging 0.98
R2422:Tlk1 UTSW 2 70770005 missense probably damaging 1.00
R3843:Tlk1 UTSW 2 70749327 missense probably benign 0.05
R3970:Tlk1 UTSW 2 70716652 missense probably damaging 1.00
R4191:Tlk1 UTSW 2 70725547 missense probably damaging 1.00
R4867:Tlk1 UTSW 2 70721571 nonsense probably null
R5022:Tlk1 UTSW 2 70742065 missense probably benign 0.10
R5275:Tlk1 UTSW 2 70752205 intron probably benign
R5469:Tlk1 UTSW 2 70721668 missense probably benign 0.15
R6531:Tlk1 UTSW 2 70742083 missense probably benign 0.00
R6592:Tlk1 UTSW 2 70714153 missense probably damaging 1.00
R6797:Tlk1 UTSW 2 70738426 nonsense probably null
R7030:Tlk1 UTSW 2 70721928 missense probably damaging 1.00
R7705:Tlk1 UTSW 2 70786672 intron probably null
R7970:Tlk1 UTSW 2 70752300 missense possibly damaging 0.64
X0028:Tlk1 UTSW 2 70746031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTCCTTGGAGAGCTTAGTTCAC -3'
(R):5'- AACTGTCCTTGCTGCTGTGG -3'

Sequencing Primer
(F):5'- GGAGAGCTTAGTTCACAAACACTTC -3'
(R):5'- AGAAGGTAGGAGATGATTGTGTTGC -3'
Posted On2020-07-28