Incidental Mutation 'R0724:Thoc1'
ID63836
Institutional Source Beutler Lab
Gene Symbol Thoc1
Ensembl Gene ENSMUSG00000024287
Gene NameTHO complex 1
Synonyms3110002N20Rik, NMP-84
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0724 (G1)
Quality Score170
Status Validated
Chromosome18
Chromosomal Location9958180-9995484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9963829 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 144 (L144P)
Ref Sequence ENSEMBL: ENSMUSP00000025137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025137]
Predicted Effect probably damaging
Transcript: ENSMUST00000025137
AA Change: L144P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025137
Gene: ENSMUSG00000024287
AA Change: L144P

DomainStartEndE-ValueType
Pfam:efThoc1 69 546 7.2e-149 PFAM
DEATH 560 653 1.27e-24 SMART
Meta Mutation Damage Score 0.8870 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HPR1 is part of the TREX (transcription/export) complex, which includes TEX1 (MIM 606929), THO2 (MIM 300395), ALY (MIM 604171), and UAP56 (MIM 142560).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mutations in this gene result in embryonic lethality around implantation in homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Thoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Thoc1 APN 18 9989744 missense possibly damaging 0.90
IGL01313:Thoc1 APN 18 9987158 missense probably benign 0.05
IGL01501:Thoc1 APN 18 9986321 missense possibly damaging 0.96
IGL01533:Thoc1 APN 18 9962376 missense probably benign 0.02
IGL01821:Thoc1 APN 18 9993429 missense probably benign
IGL01838:Thoc1 APN 18 9993386 missense possibly damaging 0.94
IGL02193:Thoc1 APN 18 9992863 missense probably benign 0.01
IGL02531:Thoc1 APN 18 9970258 missense probably benign
IGL03203:Thoc1 APN 18 9960483 splice site probably benign
R0831:Thoc1 UTSW 18 9963267 missense probably benign 0.00
R2196:Thoc1 UTSW 18 9986300 missense probably damaging 0.99
R2256:Thoc1 UTSW 18 9993466 missense possibly damaging 0.85
R2257:Thoc1 UTSW 18 9993466 missense possibly damaging 0.85
R2289:Thoc1 UTSW 18 9984488 missense probably damaging 1.00
R2508:Thoc1 UTSW 18 9977947 missense probably damaging 0.99
R2937:Thoc1 UTSW 18 9959255 missense probably damaging 0.96
R3967:Thoc1 UTSW 18 9968787 missense probably damaging 0.99
R4012:Thoc1 UTSW 18 9987651 missense possibly damaging 0.87
R4320:Thoc1 UTSW 18 9960493 missense probably benign
R4686:Thoc1 UTSW 18 9970312 nonsense probably null
R4811:Thoc1 UTSW 18 9993438 missense probably damaging 0.97
R4962:Thoc1 UTSW 18 9962387 missense probably benign 0.01
R5486:Thoc1 UTSW 18 9992204 missense probably benign 0.39
R5648:Thoc1 UTSW 18 9962390 missense possibly damaging 0.94
R6291:Thoc1 UTSW 18 9993330 missense probably benign
R6406:Thoc1 UTSW 18 9977963 missense probably damaging 1.00
R6458:Thoc1 UTSW 18 9993333 missense probably benign
R7379:Thoc1 UTSW 18 9992902 missense probably benign 0.25
R7580:Thoc1 UTSW 18 9986343 missense probably damaging 0.98
R7685:Thoc1 UTSW 18 9993454 nonsense probably null
R7795:Thoc1 UTSW 18 9986300 missense probably damaging 0.96
R7799:Thoc1 UTSW 18 9984441 missense probably damaging 1.00
X0057:Thoc1 UTSW 18 9992178 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTGACCAGAAGAATAGGTGTTGGTGG -3'
(R):5'- ACATGCATTTACACAGCCAGGTAAATCA -3'

Sequencing Primer
(F):5'- ctcaaactcagaaatccgcc -3'
(R):5'- ACTATGATTCAGTAGCACCCTG -3'
Posted On2013-07-30