Incidental Mutation 'R0724:Oacyl'
List |< first << previous [record 38 of 55] next >> last >|
ID63837
Institutional Source Beutler Lab
Gene Symbol Oacyl
Ensembl Gene ENSMUSG00000046610
Gene NameO-acyltransferase like
Synonyms5330437I02Rik
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0724 (G1)
Quality Score82
Status Validated
Chromosome18
Chromosomal Location65698268-65751601 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 65737825 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115097] [ENSMUST00000117694]
Predicted Effect probably benign
Transcript: ENSMUST00000115097
SMART Domains Protein: ENSMUSP00000110749
Gene: ENSMUSG00000046610

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
NRF 24 145 3.58e-13 SMART
Blast:NRF 152 191 1e-6 BLAST
Pfam:Acyl_transf_3 274 664 6.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117694
SMART Domains Protein: ENSMUSP00000113626
Gene: ENSMUSG00000046610

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:NRF 24 118 4e-14 BLAST
Pfam:Acyl_transf_3 201 591 6.7e-23 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
H2-Eb1 T C 17: 34,315,032 probably benign Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in Oacyl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Oacyl APN 18 65749640 missense possibly damaging 0.65
IGL00972:Oacyl APN 18 65725501 missense possibly damaging 0.95
IGL01970:Oacyl APN 18 65749714 missense possibly damaging 0.77
IGL02030:Oacyl APN 18 65737910 missense probably damaging 0.99
IGL02706:Oacyl APN 18 65749721 missense probably damaging 1.00
R0529:Oacyl UTSW 18 65742219 missense probably damaging 0.97
R0607:Oacyl UTSW 18 65747891 missense possibly damaging 0.61
R1138:Oacyl UTSW 18 65725450 missense probably damaging 1.00
R1482:Oacyl UTSW 18 65737972 missense probably damaging 1.00
R1551:Oacyl UTSW 18 65742209 missense probably benign 0.02
R1649:Oacyl UTSW 18 65750096 missense probably damaging 1.00
R1919:Oacyl UTSW 18 65710547 missense possibly damaging 0.87
R4271:Oacyl UTSW 18 65737967 missense probably damaging 1.00
R5443:Oacyl UTSW 18 65750182 missense probably benign
R5525:Oacyl UTSW 18 65745356 missense probably benign 0.00
R5879:Oacyl UTSW 18 65749672 missense probably damaging 1.00
R6132:Oacyl UTSW 18 65726355 missense probably damaging 1.00
R6367:Oacyl UTSW 18 65725444 missense probably damaging 1.00
R7009:Oacyl UTSW 18 65722538 nonsense probably null
R7097:Oacyl UTSW 18 65720252 missense probably benign 0.00
R7122:Oacyl UTSW 18 65720252 missense probably benign 0.00
R7132:Oacyl UTSW 18 65698409 missense probably damaging 1.00
R7260:Oacyl UTSW 18 65698367 missense probably damaging 1.00
R7403:Oacyl UTSW 18 65737895 missense probably benign 0.15
R7501:Oacyl UTSW 18 65725298 intron probably null
R7759:Oacyl UTSW 18 65710560 missense probably damaging 1.00
R7892:Oacyl UTSW 18 65737847 missense probably benign 0.00
R7975:Oacyl UTSW 18 65737847 missense probably benign 0.00
Z1177:Oacyl UTSW 18 65725347 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGGAAGAACATGCACTGTACCCATC -3'
(R):5'- AACTCACGGCATTCTGGACAGAC -3'

Sequencing Primer
(F):5'- CCCATCTTACAGGTGAATGACTGG -3'
(R):5'- TCTGGACAGACAGGAAGTTATTC -3'
Posted On2013-07-30