Incidental Mutation 'R0708:Col9a1'
ID 63838
Institutional Source Beutler Lab
Gene Symbol Col9a1
Ensembl Gene ENSMUSG00000026147
Gene Name collagen, type IX, alpha 1
Synonyms Col9a-1
MMRRC Submission 038891-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R0708 (G1)
Quality Score 125
Status Not validated
Chromosome 1
Chromosomal Location 24216691-24291765 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24276342 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 750 (Q750L)
Ref Sequence ENSEMBL: ENSMUSP00000051579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054588] [ENSMUST00000088349]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000054588
AA Change: Q750L

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051579
Gene: ENSMUSG00000026147
AA Change: Q750L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 50 244 5.73e-78 SMART
Pfam:Collagen 266 326 2e-11 PFAM
Pfam:Collagen 308 358 3.5e-9 PFAM
Pfam:Collagen 357 409 1.2e-8 PFAM
Pfam:Collagen 415 472 7.8e-11 PFAM
Pfam:Collagen 454 515 2.9e-11 PFAM
Pfam:Collagen 592 667 3.9e-8 PFAM
Pfam:Collagen 646 716 1.7e-9 PFAM
Pfam:Collagen 697 760 1.6e-10 PFAM
Pfam:Collagen 785 848 3.1e-11 PFAM
low complexity region 878 899 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000088349
AA Change: Q509L

PolyPhen 2 Score 0.760 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000085687
Gene: ENSMUSG00000026147
AA Change: Q509L

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:Collagen 24 85 1.5e-11 PFAM
Pfam:Collagen 66 117 2.7e-9 PFAM
Pfam:Collagen 115 168 2.8e-8 PFAM
Pfam:Collagen 174 231 5.5e-11 PFAM
Pfam:Collagen 213 274 1.9e-11 PFAM
low complexity region 353 391 N/A INTRINSIC
Pfam:Collagen 405 479 1.3e-9 PFAM
Pfam:Collagen 456 519 1e-10 PFAM
Pfam:Collagen 544 607 2.4e-11 PFAM
low complexity region 637 658 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, which is a minor (5-20%) collagen component of hyaline cartilage. Type IX collagen is usually found in tissues containing type II collagen, a fibrillar collagen. Studies in knockout mice have shown that synthesis of the alpha 1 chain is essential for assembly of type IX collagen molecules, a heterotrimeric molecule, and that lack of type IX collagen is associated with early onset osteoarthritis. Mutations in this gene are associated with osteoarthritis in humans, with multiple epiphyseal dysplasia, 6, a form of chondrodysplasia, and with Stickler syndrome, a disease characterized by ophthalmic, orofacial, articular, and auditory defects. Two transcript variants that encode different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation show no conspicuous skeletal abnormalities at birth but develop early-onset degenerative joint disease resembling osteoarthritis as well as progressive hearing loss; restoration and remodeling of trabecular bone is perturbed with minimal effects on cortical bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brdt A T 5: 107,506,766 (GRCm39) K450* probably null Het
Cand2 G A 6: 115,780,766 (GRCm39) E1217K probably damaging Het
Dnah6 A T 6: 73,189,605 (GRCm39) S14R probably benign Het
Enox1 A G 14: 77,830,352 (GRCm39) N319S probably benign Het
Frs2 G A 10: 116,909,997 (GRCm39) T455M probably damaging Het
Glra3 C T 8: 56,578,399 (GRCm39) probably benign Het
Gmppa T C 1: 75,419,218 (GRCm39) F375S probably damaging Het
Hectd4 G A 5: 121,424,526 (GRCm39) probably null Het
Hgf C A 5: 16,771,761 (GRCm39) C129* probably null Het
Insc T A 7: 114,444,381 (GRCm39) V456E probably damaging Het
Ints14 G A 9: 64,891,266 (GRCm39) V416I probably benign Het
Klk1b11 T C 7: 43,647,152 (GRCm39) F29L possibly damaging Het
Ogfod1 C T 8: 94,765,673 (GRCm39) L79F possibly damaging Het
Or8d2b T A 9: 38,788,571 (GRCm39) V33E probably damaging Het
Orc3 A T 4: 34,597,368 (GRCm39) I224N probably damaging Het
Papss2 T C 19: 32,614,616 (GRCm39) F111L probably damaging Het
Poc1b A G 10: 98,990,992 (GRCm39) D291G probably null Het
Prl8a8 A T 13: 27,695,528 (GRCm39) M72K possibly damaging Het
Ptpn7 C A 1: 135,062,285 (GRCm39) T77K probably damaging Het
Ptpro T C 6: 137,363,251 (GRCm39) S462P probably benign Het
Rab3gap2 T A 1: 184,982,123 (GRCm39) S392T probably damaging Het
Sema4d A G 13: 51,866,755 (GRCm39) V245A probably benign Het
Sgcb A T 5: 73,798,225 (GRCm39) probably null Het
Slc24a1 T A 9: 64,855,172 (GRCm39) K578N unknown Het
Sptbn1 A T 11: 30,064,739 (GRCm39) V1920E probably damaging Het
Tecr A T 8: 84,299,738 (GRCm39) I101N probably damaging Het
Tectb T C 19: 55,179,984 (GRCm39) F277L probably benign Het
Tgs1 T A 4: 3,586,152 (GRCm39) L343H probably benign Het
Thbs4 C A 13: 92,909,694 (GRCm39) G368W probably damaging Het
Zfp558 T C 9: 18,368,123 (GRCm39) S222G possibly damaging Het
Other mutations in Col9a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Col9a1 APN 1 24,224,306 (GRCm39) missense unknown
IGL00517:Col9a1 APN 1 24,234,615 (GRCm39) intron probably benign
IGL01125:Col9a1 APN 1 24,263,726 (GRCm39) critical splice acceptor site probably null
IGL01505:Col9a1 APN 1 24,224,205 (GRCm39) missense unknown
IGL01583:Col9a1 APN 1 24,224,225 (GRCm39) missense unknown
IGL01627:Col9a1 APN 1 24,218,689 (GRCm39) critical splice donor site probably null
IGL01773:Col9a1 APN 1 24,244,147 (GRCm39) missense probably benign 0.17
IGL02117:Col9a1 APN 1 24,276,574 (GRCm39) nonsense probably null
IGL02192:Col9a1 APN 1 24,261,068 (GRCm39) missense probably damaging 1.00
IGL02346:Col9a1 APN 1 24,262,690 (GRCm39) missense probably damaging 0.96
IGL02383:Col9a1 APN 1 24,224,339 (GRCm39) missense unknown
IGL02453:Col9a1 APN 1 24,218,438 (GRCm39) missense unknown
IGL02553:Col9a1 APN 1 24,261,018 (GRCm39) splice site probably benign
IGL03412:Col9a1 APN 1 24,249,508 (GRCm39) critical splice donor site probably null
IGL03493:Col9a1 APN 1 24,260,651 (GRCm39) splice site probably benign
ANU74:Col9a1 UTSW 1 24,224,409 (GRCm39) missense unknown
R0076:Col9a1 UTSW 1 24,276,578 (GRCm39) critical splice donor site probably null
R0076:Col9a1 UTSW 1 24,276,578 (GRCm39) critical splice donor site probably null
R0090:Col9a1 UTSW 1 24,262,643 (GRCm39) splice site probably null
R0356:Col9a1 UTSW 1 24,224,328 (GRCm39) nonsense probably null
R0562:Col9a1 UTSW 1 24,218,360 (GRCm39) splice site probably null
R0584:Col9a1 UTSW 1 24,263,571 (GRCm39) splice site probably benign
R1342:Col9a1 UTSW 1 24,262,701 (GRCm39) critical splice donor site probably null
R1445:Col9a1 UTSW 1 24,276,579 (GRCm39) critical splice donor site probably null
R1791:Col9a1 UTSW 1 24,224,386 (GRCm39) missense unknown
R1938:Col9a1 UTSW 1 24,261,554 (GRCm39) missense probably damaging 1.00
R2214:Col9a1 UTSW 1 24,247,283 (GRCm39) missense probably damaging 1.00
R2240:Col9a1 UTSW 1 24,218,582 (GRCm39) missense unknown
R3757:Col9a1 UTSW 1 24,271,312 (GRCm39) critical splice donor site probably null
R3891:Col9a1 UTSW 1 24,224,517 (GRCm39) critical splice donor site probably null
R4249:Col9a1 UTSW 1 24,283,462 (GRCm39) missense probably damaging 1.00
R4690:Col9a1 UTSW 1 24,263,787 (GRCm39) splice site probably null
R4918:Col9a1 UTSW 1 24,276,339 (GRCm39) missense possibly damaging 0.74
R4988:Col9a1 UTSW 1 24,224,273 (GRCm39) missense unknown
R5144:Col9a1 UTSW 1 24,278,434 (GRCm39) missense probably benign 0.08
R5327:Col9a1 UTSW 1 24,234,620 (GRCm39) critical splice donor site probably null
R5511:Col9a1 UTSW 1 24,218,619 (GRCm39) missense unknown
R5519:Col9a1 UTSW 1 24,269,335 (GRCm39) splice site probably null
R5564:Col9a1 UTSW 1 24,234,436 (GRCm39) start gained probably benign
R6076:Col9a1 UTSW 1 24,234,457 (GRCm39) start gained probably benign
R6478:Col9a1 UTSW 1 24,224,486 (GRCm39) missense unknown
R6886:Col9a1 UTSW 1 24,224,426 (GRCm39) missense unknown
R7177:Col9a1 UTSW 1 24,234,498 (GRCm39) missense unknown
R7259:Col9a1 UTSW 1 24,224,424 (GRCm39) missense unknown
R7268:Col9a1 UTSW 1 24,246,479 (GRCm39) missense possibly damaging 0.89
R7347:Col9a1 UTSW 1 24,218,484 (GRCm39) splice site probably null
R7644:Col9a1 UTSW 1 24,224,243 (GRCm39) missense unknown
R7860:Col9a1 UTSW 1 24,276,261 (GRCm39) missense probably damaging 1.00
R8267:Col9a1 UTSW 1 24,224,267 (GRCm39) missense unknown
R8296:Col9a1 UTSW 1 24,217,380 (GRCm39) missense unknown
R8737:Col9a1 UTSW 1 24,224,127 (GRCm39) missense unknown
R8773:Col9a1 UTSW 1 24,224,208 (GRCm39) missense unknown
R8795:Col9a1 UTSW 1 24,233,812 (GRCm39) missense unknown
R8878:Col9a1 UTSW 1 24,236,048 (GRCm39) critical splice donor site probably null
R8956:Col9a1 UTSW 1 24,276,300 (GRCm39) missense probably damaging 1.00
R8978:Col9a1 UTSW 1 24,278,396 (GRCm39) missense probably damaging 1.00
R9096:Col9a1 UTSW 1 24,224,207 (GRCm39) missense unknown
R9097:Col9a1 UTSW 1 24,224,207 (GRCm39) missense unknown
R9205:Col9a1 UTSW 1 24,224,175 (GRCm39) missense unknown
R9534:Col9a1 UTSW 1 24,224,250 (GRCm39) missense unknown
Z1176:Col9a1 UTSW 1 24,253,669 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAACTTTGCTGATGTCTAGCCC -3'
(R):5'- ACGACTCTCATGCAAACCTGCTTG -3'

Sequencing Primer
(F):5'- GTTTGTTCTAGGTGGGTAACCC -3'
(R):5'- CATGCAAACCTGCTTGATGTG -3'
Posted On 2013-07-30