Incidental Mutation 'R8284:Aff4'
ID 638389
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene Name AF4/FMR2 family, member 4
Synonyms Laf4l, Alf4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8284 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 53350833-53421830 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53404552 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 860 (K860E)
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945]
AlphaFold Q9ESC8
Predicted Effect probably damaging
Transcript: ENSMUST00000060945
AA Change: K860E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: K860E

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T C 10: 61,198,659 Y1147C possibly damaging Het
Adgrf5 T A 17: 43,455,270 S1328T unknown Het
Aox1 A C 1: 58,076,091 H745P probably damaging Het
Bpifc T C 10: 86,000,549 T31A probably benign Het
C3 C A 17: 57,223,938 V388L probably benign Het
Celsr3 G T 9: 108,846,413 M2874I probably damaging Het
Cnga4 T A 7: 105,408,032 D550E probably benign Het
Dhx8 A G 11: 101,757,629 T918A probably damaging Het
Dnah14 A C 1: 181,773,811 E3670A probably benign Het
Fbxo31 T C 8: 121,560,442 I131V probably benign Het
Ftcd T C 10: 76,578,059 V99A probably benign Het
Gm21994 T C 2: 150,255,356 probably benign Het
Gucy2e A G 11: 69,232,351 V471A probably benign Het
H60b T A 10: 22,287,072 L182Q probably benign Het
Hbp1 G A 12: 31,937,626 H188Y probably damaging Het
Itga4 C T 2: 79,321,439 T862I probably benign Het
Kcnmb4 T A 10: 116,418,253 K206N probably damaging Het
Klra4 A G 6: 130,065,280 F8S possibly damaging Het
Mrpl2 C A 17: 46,647,509 Y72* probably null Het
Nars2 C A 7: 96,951,638 probably benign Het
Nup214 T C 2: 31,996,446 S607P possibly damaging Het
Oas1d C T 5: 120,919,158 R276* probably null Het
Olfr10 A G 11: 49,318,175 T210A probably benign Het
Olfr103 C T 17: 37,336,696 V179I probably benign Het
Olfr31 T A 14: 14,329,011 L300Q possibly damaging Het
Olfr355 T A 2: 36,928,006 Y36F probably damaging Het
Pex13 A G 11: 23,655,685 S182P possibly damaging Het
Piwil4 G T 9: 14,727,478 N297K probably benign Het
Plxna4 T C 6: 32,152,854 T1845A probably benign Het
Pml T C 9: 58,229,360 N579D probably benign Het
Ppl A G 16: 5,132,337 S3P probably damaging Het
Pramef25 G T 4: 143,950,125 D136E possibly damaging Het
Prss54 G A 8: 95,559,366 Q360* probably null Het
Ralgps2 A G 1: 156,828,148 I402T probably benign Het
Rnf213 T A 11: 119,428,083 D1123E Het
Sdha A T 13: 74,331,297 probably null Het
Senp8 G A 9: 59,737,531 T114I Het
Setx C T 2: 29,145,336 T611I possibly damaging Het
Shc1 T G 3: 89,421,908 S20A possibly damaging Het
Slc15a1 T C 14: 121,489,863 I98V probably benign Het
Snrk A G 9: 122,160,472 E294G probably damaging Het
Sox18 G A 2: 181,670,958 P127S probably damaging Het
Spta1 A G 1: 174,179,821 T206A probably benign Het
Tcfl5 A G 2: 180,638,537 S358P probably benign Het
Tecta T A 9: 42,378,029 L413F possibly damaging Het
Tlk1 T C 2: 70,714,021 T757A probably benign Het
Tmem232 T A 17: 65,402,995 I433F probably damaging Het
Top1mt T A 15: 75,667,863 K300* probably null Het
Trbv20 C T 6: 41,188,848 A69V probably damaging Het
Trim12a A T 7: 104,306,075 L147Q probably damaging Het
Tuba8 G A 6: 121,222,777 S140N probably damaging Het
Vcan A T 13: 89,704,335 N835K possibly damaging Het
Xrcc1 G A 7: 24,572,278 R562H probably damaging Het
Yipf7 C T 5: 69,517,196 G202D probably benign Het
Ythdc1 T G 5: 86,816,466 S45A probably benign Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53372999 missense probably damaging 1.00
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53399619 missense probably damaging 1.00
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5477:Aff4 UTSW 11 53408472 critical splice donor site probably null
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6576:Aff4 UTSW 11 53400441 missense probably damaging 1.00
R6764:Aff4 UTSW 11 53399830 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
R7755:Aff4 UTSW 11 53398379 missense probably damaging 0.97
R7848:Aff4 UTSW 11 53404512 missense probably benign 0.05
R7968:Aff4 UTSW 11 53409348 missense probably damaging 1.00
R8159:Aff4 UTSW 11 53411894 missense possibly damaging 0.71
R8218:Aff4 UTSW 11 53398257 missense probably damaging 0.98
R8241:Aff4 UTSW 11 53400171 missense probably benign 0.00
R8373:Aff4 UTSW 11 53400267 nonsense probably null
R8695:Aff4 UTSW 11 53368682 missense probably damaging 1.00
R8777:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8777-TAIL:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8780:Aff4 UTSW 11 53380617 missense probably damaging 1.00
R8798:Aff4 UTSW 11 53400508 critical splice donor site probably benign
R8838:Aff4 UTSW 11 53406638 missense possibly damaging 0.77
R8939:Aff4 UTSW 11 53372404 missense probably benign
R9146:Aff4 UTSW 11 53408136 missense probably benign 0.06
R9329:Aff4 UTSW 11 53397859 missense probably damaging 1.00
R9378:Aff4 UTSW 11 53372479 missense probably damaging 0.98
R9471:Aff4 UTSW 11 53380646 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AAAAGGACTTGCTACCTTCACC -3'
(R):5'- CAGCAACAGTAGGGAGATCC -3'

Sequencing Primer
(F):5'- CTGCTGGGCCCATTCTTTCAAAAG -3'
(R):5'- GTTGTCCTTTCAGACAGACAGAC -3'
Posted On 2020-07-28