Incidental Mutation 'R8284:Slc15a1'
ID638397
Institutional Source Beutler Lab
Gene Symbol Slc15a1
Ensembl Gene ENSMUSG00000025557
Gene Namesolute carrier family 15 (oligopeptide transporter), member 1
SynonymsPECT1, PEPT1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R8284 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location121459621-121505252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121489863 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 98 (I98V)
Ref Sequence ENSEMBL: ENSMUSP00000085728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088386]
Predicted Effect probably benign
Transcript: ENSMUST00000088386
AA Change: I98V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000085728
Gene: ENSMUSG00000025557
AA Change: I98V

DomainStartEndE-ValueType
Pfam:PTR2 81 477 1.9e-141 PFAM
Pfam:PTR2 562 644 4.2e-11 PFAM
transmembrane domain 650 672 N/A INTRINSIC
low complexity region 684 695 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
PHENOTYPE: Peptide uptake in the intestine is substantially reduced in mice homozygous for a null mutation of this gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T C 10: 61,198,659 Y1147C possibly damaging Het
Adgrf5 T A 17: 43,455,270 S1328T unknown Het
Aff4 A G 11: 53,404,552 K860E probably damaging Het
Aox1 A C 1: 58,076,091 H745P probably damaging Het
Bpifc T C 10: 86,000,549 T31A probably benign Het
C3 C A 17: 57,223,938 V388L probably benign Het
Celsr3 G T 9: 108,846,413 M2874I probably damaging Het
Cnga4 T A 7: 105,408,032 D550E probably benign Het
Dhx8 A G 11: 101,757,629 T918A probably damaging Het
Dnah14 A C 1: 181,773,811 E3670A probably benign Het
Fbxo31 T C 8: 121,560,442 I131V probably benign Het
Ftcd T C 10: 76,578,059 V99A probably benign Het
Gucy2e A G 11: 69,232,351 V471A probably benign Het
H60b T A 10: 22,287,072 L182Q probably benign Het
Hbp1 G A 12: 31,937,626 H188Y probably damaging Het
Itga4 C T 2: 79,321,439 T862I probably benign Het
Kcnmb4 T A 10: 116,418,253 K206N probably damaging Het
Klra4 A G 6: 130,065,280 F8S possibly damaging Het
Mrpl2 C A 17: 46,647,509 Y72* probably null Het
Nup214 T C 2: 31,996,446 S607P possibly damaging Het
Oas1d C T 5: 120,919,158 R276* probably null Het
Olfr10 A G 11: 49,318,175 T210A probably benign Het
Olfr103 C T 17: 37,336,696 V179I probably benign Het
Olfr31 T A 14: 14,329,011 L300Q possibly damaging Het
Olfr355 T A 2: 36,928,006 Y36F probably damaging Het
Pex13 A G 11: 23,655,685 S182P possibly damaging Het
Piwil4 G T 9: 14,727,478 N297K probably benign Het
Plxna4 T C 6: 32,152,854 T1845A probably benign Het
Pml T C 9: 58,229,360 N579D probably benign Het
Ppl A G 16: 5,132,337 S3P probably damaging Het
Pramef25 G T 4: 143,950,125 D136E possibly damaging Het
Prss54 G A 8: 95,559,366 Q360* probably null Het
Ralgps2 A G 1: 156,828,148 I402T probably benign Het
Rnf213 T A 11: 119,428,083 D1123E Het
Sdha A T 13: 74,331,297 probably null Het
Senp8 G A 9: 59,737,531 T114I Het
Setx C T 2: 29,145,336 T611I possibly damaging Het
Shc1 T G 3: 89,421,908 S20A possibly damaging Het
Snrk A G 9: 122,160,472 E294G probably damaging Het
Sox18 G A 2: 181,670,958 P127S probably damaging Het
Spta1 A G 1: 174,179,821 T206A probably benign Het
Tcfl5 A G 2: 180,638,537 S358P probably benign Het
Tecta T A 9: 42,378,029 L413F possibly damaging Het
Tlk1 T C 2: 70,714,021 T757A probably benign Het
Tmem232 T A 17: 65,402,995 I433F probably damaging Het
Top1mt T A 15: 75,667,863 K300* probably null Het
Trbv20 C T 6: 41,188,848 A69V probably damaging Het
Trim12a A T 7: 104,306,075 L147Q probably damaging Het
Tuba8 G A 6: 121,222,777 S140N probably damaging Het
Vcan A T 13: 89,704,335 N835K possibly damaging Het
Xrcc1 G A 7: 24,572,278 R562H probably damaging Het
Yipf7 C T 5: 69,517,196 G202D probably benign Het
Ythdc1 T G 5: 86,816,466 S45A probably benign Het
Other mutations in Slc15a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Slc15a1 APN 14 121460679 missense possibly damaging 0.95
IGL01534:Slc15a1 APN 14 121464952 missense possibly damaging 0.95
IGL01783:Slc15a1 APN 14 121471276 critical splice donor site probably null
IGL01799:Slc15a1 APN 14 121480729 missense possibly damaging 0.76
IGL02064:Slc15a1 APN 14 121462499 missense possibly damaging 0.66
IGL02064:Slc15a1 APN 14 121462474 missense probably benign 0.20
IGL02115:Slc15a1 APN 14 121480661 missense possibly damaging 0.61
IGL02514:Slc15a1 APN 14 121487040 missense probably damaging 1.00
IGL03056:Slc15a1 APN 14 121491283 missense possibly damaging 0.82
IGL03297:Slc15a1 APN 14 121486684 missense probably damaging 1.00
R1484:Slc15a1 UTSW 14 121491239 nonsense probably null
R1532:Slc15a1 UTSW 14 121475984 missense possibly damaging 0.79
R1655:Slc15a1 UTSW 14 121465899 missense probably benign 0.34
R2013:Slc15a1 UTSW 14 121475987 missense possibly damaging 0.88
R2270:Slc15a1 UTSW 14 121479994 missense probably damaging 0.99
R2878:Slc15a1 UTSW 14 121465933 missense probably benign 0.00
R2986:Slc15a1 UTSW 14 121489809 missense probably benign 0.02
R3862:Slc15a1 UTSW 14 121484857 missense probably benign 0.06
R3863:Slc15a1 UTSW 14 121484857 missense probably benign 0.06
R3978:Slc15a1 UTSW 14 121489827 missense probably benign 0.00
R4184:Slc15a1 UTSW 14 121466162 missense probably benign 0.00
R4573:Slc15a1 UTSW 14 121487029 missense probably damaging 0.99
R4604:Slc15a1 UTSW 14 121489907 missense probably damaging 1.00
R4649:Slc15a1 UTSW 14 121478092 missense probably damaging 1.00
R5838:Slc15a1 UTSW 14 121484871 missense probably damaging 1.00
R6221:Slc15a1 UTSW 14 121464904 missense probably null 1.00
R6891:Slc15a1 UTSW 14 121476030 missense probably benign 0.00
R7626:Slc15a1 UTSW 14 121475965 missense probably benign 0.13
R7836:Slc15a1 UTSW 14 121480733 nonsense probably null
R8376:Slc15a1 UTSW 14 121480703 missense probably benign
R8408:Slc15a1 UTSW 14 121478116 missense possibly damaging 0.91
Z1088:Slc15a1 UTSW 14 121480054 missense probably benign 0.09
Z1088:Slc15a1 UTSW 14 121491044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACTTAGTCCATTGAACCACCTTC -3'
(R):5'- TGGGAGTCCTCAGTTTTACCTAG -3'

Sequencing Primer
(F):5'- CACCTTCTATACATTACTGAGTAGGG -3'
(R):5'- CCTAGTTTTGGAAAATGGGTAGAAAC -3'
Posted On2020-07-28