Mutagenetix > Incidental Mutations

Incidental Mutation 'R8284:Slc15a1'

638397

Institutional Source

Beutler Lab

Gene Symbol

Slc15a1

Ensembl Gene

ENSMUSG00000025557

Gene Name

solute carrier family 15 (oligopeptide transporter), member 1

Synonyms

PECT1, PEPT1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R8284 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121459621-121505252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121489863 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 98 (I98V)

Ref Sequence

ENSEMBL: ENSMUSP00000085728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088386]

AlphaFold

Q9JIP7

Predicted Effect

probably benign
Transcript: ENSMUST00000088386
AA Change: I98V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000085728
Gene: ENSMUSG00000025557
AA Change: I98V

Domain	Start	End	E-Value	Type
Pfam:PTR2	81	477	1.9e-141	PFAM
Pfam:PTR2	562	644	4.2e-11	PFAM
transmembrane domain	650	672	N/A	INTRINSIC
low complexity region	684	695	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
PHENOTYPE: Peptide uptake in the intestine is substantially reduced in mice homozygous for a null mutation of this gene. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts14	T	C	10: 61,198,659	Y1147C	possibly damaging	Het
Adgrf5	T	A	17: 43,455,270	S1328T	unknown	Het
Aff4	A	G	11: 53,404,552	K860E	probably damaging	Het
Aox1	A	C	1: 58,076,091	H745P	probably damaging	Het
Bpifc	T	C	10: 86,000,549	T31A	probably benign	Het
C3	C	A	17: 57,223,938	V388L	probably benign	Het
Celsr3	G	T	9: 108,846,413	M2874I	probably damaging	Het
Cnga4	T	A	7: 105,408,032	D550E	probably benign	Het
Dhx8	A	G	11: 101,757,629	T918A	probably damaging	Het
Dnah14	A	C	1: 181,773,811	E3670A	probably benign	Het
Fbxo31	T	C	8: 121,560,442	I131V	probably benign	Het
Ftcd	T	C	10: 76,578,059	V99A	probably benign	Het
Gm21994	T	C	2: 150,255,356		probably benign	Het
Gucy2e	A	G	11: 69,232,351	V471A	probably benign	Het
H60b	T	A	10: 22,287,072	L182Q	probably benign	Het
Hbp1	G	A	12: 31,937,626	H188Y	probably damaging	Het
Itga4	C	T	2: 79,321,439	T862I	probably benign	Het
Kcnmb4	T	A	10: 116,418,253	K206N	probably damaging	Het
Klra4	A	G	6: 130,065,280	F8S	possibly damaging	Het
Mrpl2	C	A	17: 46,647,509	Y72*	probably null	Het
Nars2	C	A	7: 96,951,638		probably benign	Het
Nup214	T	C	2: 31,996,446	S607P	possibly damaging	Het
Oas1d	C	T	5: 120,919,158	R276*	probably null	Het
Olfr10	A	G	11: 49,318,175	T210A	probably benign	Het
Olfr103	C	T	17: 37,336,696	V179I	probably benign	Het
Olfr31	T	A	14: 14,329,011	L300Q	possibly damaging	Het
Olfr355	T	A	2: 36,928,006	Y36F	probably damaging	Het
Pex13	A	G	11: 23,655,685	S182P	possibly damaging	Het
Piwil4	G	T	9: 14,727,478	N297K	probably benign	Het
Plxna4	T	C	6: 32,152,854	T1845A	probably benign	Het
Pml	T	C	9: 58,229,360	N579D	probably benign	Het
Ppl	A	G	16: 5,132,337	S3P	probably damaging	Het
Pramef25	G	T	4: 143,950,125	D136E	possibly damaging	Het
Prss54	G	A	8: 95,559,366	Q360*	probably null	Het
Ralgps2	A	G	1: 156,828,148	I402T	probably benign	Het
Rnf213	T	A	11: 119,428,083	D1123E		Het
Sdha	A	T	13: 74,331,297		probably null	Het
Senp8	G	A	9: 59,737,531	T114I		Het
Setx	C	T	2: 29,145,336	T611I	possibly damaging	Het
Shc1	T	G	3: 89,421,908	S20A	possibly damaging	Het
Snrk	A	G	9: 122,160,472	E294G	probably damaging	Het
Sox18	G	A	2: 181,670,958	P127S	probably damaging	Het
Spta1	A	G	1: 174,179,821	T206A	probably benign	Het
Tcfl5	A	G	2: 180,638,537	S358P	probably benign	Het
Tecta	T	A	9: 42,378,029	L413F	possibly damaging	Het
Tlk1	T	C	2: 70,714,021	T757A	probably benign	Het
Tmem232	T	A	17: 65,402,995	I433F	probably damaging	Het
Top1mt	T	A	15: 75,667,863	K300*	probably null	Het
Trbv20	C	T	6: 41,188,848	A69V	probably damaging	Het
Trim12a	A	T	7: 104,306,075	L147Q	probably damaging	Het
Tuba8	G	A	6: 121,222,777	S140N	probably damaging	Het
Vcan	A	T	13: 89,704,335	N835K	possibly damaging	Het
Xrcc1	G	A	7: 24,572,278	R562H	probably damaging	Het
Yipf7	C	T	5: 69,517,196	G202D	probably benign	Het
Ythdc1	T	G	5: 86,816,466	S45A	probably benign	Het

Other mutations in Slc15a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01337:Slc15a1	APN	14	121460679	missense	possibly damaging	0.95
IGL01534:Slc15a1	APN	14	121464952	missense	possibly damaging	0.95
IGL01783:Slc15a1	APN	14	121471276	critical splice donor site	probably null
IGL01799:Slc15a1	APN	14	121480729	missense	possibly damaging	0.76
IGL02064:Slc15a1	APN	14	121462499	missense	possibly damaging	0.66
IGL02064:Slc15a1	APN	14	121462474	missense	probably benign	0.20
IGL02115:Slc15a1	APN	14	121480661	missense	possibly damaging	0.61
IGL02514:Slc15a1	APN	14	121487040	missense	probably damaging	1.00
IGL03056:Slc15a1	APN	14	121491283	missense	possibly damaging	0.82
IGL03297:Slc15a1	APN	14	121486684	missense	probably damaging	1.00
R1484:Slc15a1	UTSW	14	121491239	nonsense	probably null
R1532:Slc15a1	UTSW	14	121475984	missense	possibly damaging	0.79
R1655:Slc15a1	UTSW	14	121465899	missense	probably benign	0.34
R2013:Slc15a1	UTSW	14	121475987	missense	possibly damaging	0.88
R2270:Slc15a1	UTSW	14	121479994	missense	probably damaging	0.99
R2878:Slc15a1	UTSW	14	121465933	missense	probably benign	0.00
R2986:Slc15a1	UTSW	14	121489809	missense	probably benign	0.02
R3862:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3863:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3978:Slc15a1	UTSW	14	121489827	missense	probably benign	0.00
R4184:Slc15a1	UTSW	14	121466162	missense	probably benign	0.00
R4573:Slc15a1	UTSW	14	121487029	missense	probably damaging	0.99
R4604:Slc15a1	UTSW	14	121489907	missense	probably damaging	1.00
R4649:Slc15a1	UTSW	14	121478092	missense	probably damaging	1.00
R5838:Slc15a1	UTSW	14	121484871	missense	probably damaging	1.00
R6221:Slc15a1	UTSW	14	121464904	missense	probably null	1.00
R6891:Slc15a1	UTSW	14	121476030	missense	probably benign	0.00
R7626:Slc15a1	UTSW	14	121475965	missense	probably benign	0.13
R7836:Slc15a1	UTSW	14	121480733	nonsense	probably null
R8376:Slc15a1	UTSW	14	121480703	missense	probably benign
R8408:Slc15a1	UTSW	14	121478116	missense	possibly damaging	0.91
R8774:Slc15a1	UTSW	14	121487011	missense	probably damaging	1.00
R8774-TAIL:Slc15a1	UTSW	14	121487011	missense	probably damaging	1.00
R8933:Slc15a1	UTSW	14	121486679	missense	probably benign	0.00
R9157:Slc15a1	UTSW	14	121464977	missense	probably benign	0.08
Z1088:Slc15a1	UTSW	14	121480054	missense	probably benign	0.09
Z1088:Slc15a1	UTSW	14	121491044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAACTTAGTCCATTGAACCACCTTC -3'
(R):5'- TGGGAGTCCTCAGTTTTACCTAG -3'

Sequencing Primer
(F):5'- CACCTTCTATACATTACTGAGTAGGG -3'
(R):5'- CCTAGTTTTGGAAAATGGGTAGAAAC -3'

Posted On

2020-07-28