Incidental Mutation 'R8284:Tmem232'
ID638404
Institutional Source Beutler Lab
Gene Symbol Tmem232
Ensembl Gene ENSMUSG00000045036
Gene Nametransmembrane protein 232
SynonymsLOC381107, E130009J12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R8284 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location65256005-65540782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65402995 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 433 (I433F)
Ref Sequence ENSEMBL: ENSMUSP00000055652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062161] [ENSMUST00000086722]
Predicted Effect probably damaging
Transcript: ENSMUST00000062161
AA Change: I433F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000055652
Gene: ENSMUSG00000045036
AA Change: I433F

DomainStartEndE-ValueType
Pfam:TMEM232 40 488 5.3e-235 PFAM
coiled coil region 598 634 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086722
AA Change: I433F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000083927
Gene: ENSMUSG00000045036
AA Change: I433F

DomainStartEndE-ValueType
low complexity region 61 67 N/A INTRINSIC
coiled coil region 598 634 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 T C 10: 61,198,659 Y1147C possibly damaging Het
Adgrf5 T A 17: 43,455,270 S1328T unknown Het
Aff4 A G 11: 53,404,552 K860E probably damaging Het
Aox1 A C 1: 58,076,091 H745P probably damaging Het
Bpifc T C 10: 86,000,549 T31A probably benign Het
C3 C A 17: 57,223,938 V388L probably benign Het
Celsr3 G T 9: 108,846,413 M2874I probably damaging Het
Cnga4 T A 7: 105,408,032 D550E probably benign Het
Dhx8 A G 11: 101,757,629 T918A probably damaging Het
Dnah14 A C 1: 181,773,811 E3670A probably benign Het
Fbxo31 T C 8: 121,560,442 I131V probably benign Het
Ftcd T C 10: 76,578,059 V99A probably benign Het
Gucy2e A G 11: 69,232,351 V471A probably benign Het
H60b T A 10: 22,287,072 L182Q probably benign Het
Hbp1 G A 12: 31,937,626 H188Y probably damaging Het
Itga4 C T 2: 79,321,439 T862I probably benign Het
Kcnmb4 T A 10: 116,418,253 K206N probably damaging Het
Klra4 A G 6: 130,065,280 F8S possibly damaging Het
Mrpl2 C A 17: 46,647,509 Y72* probably null Het
Nup214 T C 2: 31,996,446 S607P possibly damaging Het
Oas1d C T 5: 120,919,158 R276* probably null Het
Olfr10 A G 11: 49,318,175 T210A probably benign Het
Olfr103 C T 17: 37,336,696 V179I probably benign Het
Olfr31 T A 14: 14,329,011 L300Q possibly damaging Het
Olfr355 T A 2: 36,928,006 Y36F probably damaging Het
Pex13 A G 11: 23,655,685 S182P possibly damaging Het
Piwil4 G T 9: 14,727,478 N297K probably benign Het
Plxna4 T C 6: 32,152,854 T1845A probably benign Het
Pml T C 9: 58,229,360 N579D probably benign Het
Ppl A G 16: 5,132,337 S3P probably damaging Het
Pramef25 G T 4: 143,950,125 D136E possibly damaging Het
Prss54 G A 8: 95,559,366 Q360* probably null Het
Ralgps2 A G 1: 156,828,148 I402T probably benign Het
Rnf213 T A 11: 119,428,083 D1123E Het
Sdha A T 13: 74,331,297 probably null Het
Senp8 G A 9: 59,737,531 T114I Het
Setx C T 2: 29,145,336 T611I possibly damaging Het
Shc1 T G 3: 89,421,908 S20A possibly damaging Het
Slc15a1 T C 14: 121,489,863 I98V probably benign Het
Snrk A G 9: 122,160,472 E294G probably damaging Het
Sox18 G A 2: 181,670,958 P127S probably damaging Het
Spta1 A G 1: 174,179,821 T206A probably benign Het
Tcfl5 A G 2: 180,638,537 S358P probably benign Het
Tecta T A 9: 42,378,029 L413F possibly damaging Het
Tlk1 T C 2: 70,714,021 T757A probably benign Het
Top1mt T A 15: 75,667,863 K300* probably null Het
Trbv20 C T 6: 41,188,848 A69V probably damaging Het
Trim12a A T 7: 104,306,075 L147Q probably damaging Het
Tuba8 G A 6: 121,222,777 S140N probably damaging Het
Vcan A T 13: 89,704,335 N835K possibly damaging Het
Xrcc1 G A 7: 24,572,278 R562H probably damaging Het
Yipf7 C T 5: 69,517,196 G202D probably benign Het
Ythdc1 T G 5: 86,816,466 S45A probably benign Het
Other mutations in Tmem232
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Tmem232 APN 17 65256574 missense possibly damaging 0.71
IGL00954:Tmem232 APN 17 65500153 missense probably damaging 1.00
IGL01530:Tmem232 APN 17 65256548 nonsense probably null
IGL02881:Tmem232 APN 17 65450370 missense probably damaging 1.00
IGL02969:Tmem232 APN 17 65256563 missense possibly damaging 0.69
IGL02972:Tmem232 APN 17 65476673 missense probably benign 0.00
IGL03028:Tmem232 APN 17 65256389 missense probably benign 0.14
IGL03293:Tmem232 APN 17 65450374 missense probably damaging 1.00
R0380:Tmem232 UTSW 17 65256448 missense probably benign 0.23
R0432:Tmem232 UTSW 17 65256503 missense probably damaging 0.99
R0524:Tmem232 UTSW 17 65485942 missense probably damaging 0.98
R0548:Tmem232 UTSW 17 65382620 missense probably benign 0.22
R1345:Tmem232 UTSW 17 65450406 missense possibly damaging 0.60
R1521:Tmem232 UTSW 17 65484501 missense probably damaging 0.99
R1954:Tmem232 UTSW 17 65484487 missense probably benign 0.01
R1955:Tmem232 UTSW 17 65484487 missense probably benign 0.01
R2012:Tmem232 UTSW 17 65500172 missense probably benign 0.21
R2294:Tmem232 UTSW 17 65450441 missense probably benign 0.00
R2369:Tmem232 UTSW 17 65402997 missense probably damaging 1.00
R2384:Tmem232 UTSW 17 65402857 missense probably damaging 1.00
R2894:Tmem232 UTSW 17 65450413 missense probably damaging 1.00
R3431:Tmem232 UTSW 17 65265302 splice site probably null
R3788:Tmem232 UTSW 17 65382633 missense possibly damaging 0.71
R3789:Tmem232 UTSW 17 65382525 missense probably benign 0.02
R3789:Tmem232 UTSW 17 65382633 missense possibly damaging 0.71
R4155:Tmem232 UTSW 17 65436333 missense probably damaging 0.97
R4691:Tmem232 UTSW 17 65265242 missense possibly damaging 0.88
R4838:Tmem232 UTSW 17 65430888 missense probably benign 0.04
R5340:Tmem232 UTSW 17 65402998 missense possibly damaging 0.92
R5619:Tmem232 UTSW 17 65486511 missense probably benign 0.06
R6176:Tmem232 UTSW 17 65485872 missense probably damaging 1.00
R6192:Tmem232 UTSW 17 65430805 missense probably damaging 1.00
R6223:Tmem232 UTSW 17 65500196 start codon destroyed probably null 0.99
R6256:Tmem232 UTSW 17 65478402 missense possibly damaging 0.89
R6782:Tmem232 UTSW 17 65500124 missense possibly damaging 0.88
R6856:Tmem232 UTSW 17 65450310 missense possibly damaging 0.57
R7262:Tmem232 UTSW 17 65500117 missense probably benign
R7459:Tmem232 UTSW 17 65256389 missense probably benign 0.14
R7699:Tmem232 UTSW 17 65265218 missense probably damaging 0.97
R7700:Tmem232 UTSW 17 65265218 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCACTTTCCGTAGAGAGCTG -3'
(R):5'- GGAGAGTGTTCTGAATTTCAATTTCTC -3'

Sequencing Primer
(F):5'- CTTTCCGTAGAGAGCTGCTAAAC -3'
(R):5'- CATGCATTAGAAAGCATGTTCT -3'
Posted On2020-07-28