Incidental Mutation 'R8285:Olfr1094'
ID638406
Institutional Source Beutler Lab
Gene Symbol Olfr1094
Ensembl Gene ENSMUSG00000044213
Gene Nameolfactory receptor 1094
SynonymsGA_x6K02T2Q125-48321457-48322449, MOR179-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R8285 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86824663-86830282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86829099 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 116 (F116L)
Ref Sequence ENSEMBL: ENSMUSP00000100846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105211]
Predicted Effect probably benign
Transcript: ENSMUST00000105211
AA Change: F116L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000100846
Gene: ENSMUSG00000044213
AA Change: F116L

DomainStartEndE-ValueType
Pfam:7tm_4 43 320 4.6e-52 PFAM
Pfam:7tm_1 53 316 3.5e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 A G 10: 89,068,217 I206T probably damaging Het
Atp5j A G 16: 84,828,502 L71P probably damaging Het
Bcar3 A T 3: 122,512,734 I468F probably benign Het
Ddi1 T A 9: 6,265,808 Q187L probably benign Het
Dgkh T C 14: 78,628,126 N139D probably benign Het
Fan1 A T 7: 64,366,600 I592N probably damaging Het
Fchsd2 T C 7: 101,233,921 F252S possibly damaging Het
Gad2 T A 2: 22,624,928 N139K probably benign Het
Gm12695 G A 4: 96,769,753 R60W possibly damaging Het
Gm13023 T A 4: 143,794,066 D293E probably benign Het
Gucy1b2 A G 14: 62,420,107 V224A probably damaging Het
Hspg2 A G 4: 137,512,663 D514G probably benign Het
Igsf23 T C 7: 19,941,956 D113G possibly damaging Het
Inhbc T C 10: 127,370,141 T86A probably benign Het
Itga11 T C 9: 62,752,258 S431P probably damaging Het
Kif13b A G 14: 64,782,376 H1398R probably benign Het
Lce1f T C 3: 92,718,931 S140G unknown Het
Mapt T A 11: 104,298,802 D215E probably benign Het
Maz T C 7: 127,025,472 Y292C possibly damaging Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Mpo A G 11: 87,797,567 M351V probably benign Het
Muc16 G A 9: 18,642,977 P4007S unknown Het
Olfr1297 A T 2: 111,622,045 S10T probably benign Het
Olfr196 G A 16: 59,167,813 T110I probably benign Het
Ppp3ca A G 3: 136,881,444 D229G probably damaging Het
Rab39 A T 9: 53,705,931 I62N probably damaging Het
Rgs6 A G 12: 83,116,175 E385G probably benign Het
Scaf8 T C 17: 3,177,129 S340P unknown Het
Scpep1 A G 11: 88,952,467 L55P probably damaging Het
Sorbs2 T C 8: 45,796,067 L785P probably damaging Het
Supt16 A T 14: 52,181,083 V239E possibly damaging Het
Usf3 T C 16: 44,220,844 S1896P probably damaging Het
Xrcc1 G A 7: 24,572,278 R562H probably damaging Het
Zfhx4 C T 3: 5,401,856 T2383I probably benign Het
Other mutations in Olfr1094
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02839:Olfr1094 APN 2 86829368 missense probably benign
IGL03053:Olfr1094 APN 2 86829263 missense possibly damaging 0.93
IGL03168:Olfr1094 APN 2 86829263 missense possibly damaging 0.93
IGL02799:Olfr1094 UTSW 2 86828956 missense probably damaging 0.99
R0511:Olfr1094 UTSW 2 86829606 missense probably benign 0.02
R0944:Olfr1094 UTSW 2 86828937 missense probably benign 0.01
R1065:Olfr1094 UTSW 2 86829544 missense probably damaging 0.98
R1476:Olfr1094 UTSW 2 86829198 missense probably benign 0.31
R1807:Olfr1094 UTSW 2 86829101 missense probably benign 0.03
R2865:Olfr1094 UTSW 2 86828854 missense probably benign 0.21
R2915:Olfr1094 UTSW 2 86829226 missense probably benign 0.02
R3055:Olfr1094 UTSW 2 86829127 missense possibly damaging 0.94
R3104:Olfr1094 UTSW 2 86829691 missense probably benign 0.03
R4862:Olfr1094 UTSW 2 86829532 missense probably damaging 1.00
R4874:Olfr1094 UTSW 2 86829254 missense probably damaging 0.98
R5505:Olfr1094 UTSW 2 86829501 missense possibly damaging 0.88
R5507:Olfr1094 UTSW 2 86829317 missense probably damaging 1.00
R6318:Olfr1094 UTSW 2 86829654 missense possibly damaging 0.73
R6538:Olfr1094 UTSW 2 86829525 missense possibly damaging 0.55
R8058:Olfr1094 UTSW 2 86829708 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCAACTTAGGACTTGTTTTGC -3'
(R):5'- GCCTAATCTCATTGGATGCAC -3'

Sequencing Primer
(F):5'- CTTGTCATTGGAGATTCCCGGC -3'
(R):5'- AAGGTAGCCACTGTATGTATAGTAGC -3'
Posted On2020-07-28