Incidental Mutation 'R8285:Usf3'
ID638436
Institutional Source Beutler Lab
Gene Symbol Usf3
Ensembl Gene ENSMUSG00000068284
Gene Nameupstream transcription factor family member 3
SynonymsLOC207806, Gm608, LOC385650, 5530400K22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R8285 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location44173246-44227465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44220844 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1896 (S1896P)
Ref Sequence ENSEMBL: ENSMUSP00000112620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119746] [ENSMUST00000169582]
Predicted Effect probably damaging
Transcript: ENSMUST00000119746
AA Change: S1896P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112620
Gene: ENSMUSG00000068284
AA Change: S1896P

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
low complexity region 151 162 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 571 587 N/A INTRINSIC
low complexity region 765 782 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 1084 1100 N/A INTRINSIC
low complexity region 1370 1382 N/A INTRINSIC
low complexity region 1419 1437 N/A INTRINSIC
low complexity region 1527 1555 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169582
AA Change: S1896P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128627
Gene: ENSMUSG00000068284
AA Change: S1896P

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
low complexity region 151 162 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 571 587 N/A INTRINSIC
low complexity region 765 782 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 1084 1100 N/A INTRINSIC
low complexity region 1370 1382 N/A INTRINSIC
low complexity region 1419 1437 N/A INTRINSIC
low complexity region 1527 1555 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 A G 10: 89,068,217 I206T probably damaging Het
Atp5j A G 16: 84,828,502 L71P probably damaging Het
Bcar3 A T 3: 122,512,734 I468F probably benign Het
Ddi1 T A 9: 6,265,808 Q187L probably benign Het
Dgkh T C 14: 78,628,126 N139D probably benign Het
Fan1 A T 7: 64,366,600 I592N probably damaging Het
Fchsd2 T C 7: 101,233,921 F252S possibly damaging Het
Gad2 T A 2: 22,624,928 N139K probably benign Het
Gm12695 G A 4: 96,769,753 R60W possibly damaging Het
Gm13023 T A 4: 143,794,066 D293E probably benign Het
Gucy1b2 A G 14: 62,420,107 V224A probably damaging Het
Hspg2 A G 4: 137,512,663 D514G probably benign Het
Igsf23 T C 7: 19,941,956 D113G possibly damaging Het
Inhbc T C 10: 127,370,141 T86A probably benign Het
Itga11 T C 9: 62,752,258 S431P probably damaging Het
Kif13b A G 14: 64,782,376 H1398R probably benign Het
Lce1f T C 3: 92,718,931 S140G unknown Het
Mapt T A 11: 104,298,802 D215E probably benign Het
Maz T C 7: 127,025,472 Y292C possibly damaging Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Mpo A G 11: 87,797,567 M351V probably benign Het
Muc16 G A 9: 18,642,977 P4007S unknown Het
Olfr1094 T C 2: 86,829,099 F116L probably benign Het
Olfr1297 A T 2: 111,622,045 S10T probably benign Het
Olfr196 G A 16: 59,167,813 T110I probably benign Het
Ppp3ca A G 3: 136,881,444 D229G probably damaging Het
Rab39 A T 9: 53,705,931 I62N probably damaging Het
Rgs6 A G 12: 83,116,175 E385G probably benign Het
Scaf8 T C 17: 3,177,129 S340P unknown Het
Scpep1 A G 11: 88,952,467 L55P probably damaging Het
Sorbs2 T C 8: 45,796,067 L785P probably damaging Het
Supt16 A T 14: 52,181,083 V239E possibly damaging Het
Xrcc1 G A 7: 24,572,278 R562H probably damaging Het
Zfhx4 C T 3: 5,401,856 T2383I probably benign Het
Other mutations in Usf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Usf3 APN 16 44212637 splice site probably null
IGL01971:Usf3 APN 16 44217446 splice site probably null
IGL01982:Usf3 APN 16 44218817 missense possibly damaging 0.89
IGL02124:Usf3 APN 16 44219656 missense possibly damaging 0.82
IGL02309:Usf3 APN 16 44200663 missense probably benign 0.20
IGL02454:Usf3 APN 16 44217182 missense probably damaging 1.00
IGL02526:Usf3 APN 16 44220311 missense possibly damaging 0.89
IGL02671:Usf3 APN 16 44221781 missense probably damaging 1.00
IGL02800:Usf3 APN 16 44219096 missense probably benign 0.00
IGL02899:Usf3 APN 16 44221226 missense probably damaging 1.00
IGL03223:Usf3 APN 16 44216450 missense probably damaging 1.00
I1329:Usf3 UTSW 16 44220530 missense probably damaging 1.00
R0208:Usf3 UTSW 16 44216906 missense probably damaging 0.98
R0900:Usf3 UTSW 16 44215958 missense probably benign
R1160:Usf3 UTSW 16 44218547 missense probably damaging 1.00
R1417:Usf3 UTSW 16 44217449 missense probably benign 0.00
R1512:Usf3 UTSW 16 44221198 missense probably damaging 1.00
R1603:Usf3 UTSW 16 44218172 missense probably benign
R1702:Usf3 UTSW 16 44219632 nonsense probably null
R1774:Usf3 UTSW 16 44215670 missense probably damaging 1.00
R2344:Usf3 UTSW 16 44216051 missense probably benign
R2400:Usf3 UTSW 16 44215747 missense probably benign 0.04
R2484:Usf3 UTSW 16 44220682 missense probably damaging 0.99
R2570:Usf3 UTSW 16 44216381 missense probably benign 0.00
R3730:Usf3 UTSW 16 44218575 missense probably benign 0.00
R4024:Usf3 UTSW 16 44216165 missense possibly damaging 0.76
R4451:Usf3 UTSW 16 44217888 missense possibly damaging 0.76
R4883:Usf3 UTSW 16 44219579 missense probably damaging 1.00
R4895:Usf3 UTSW 16 44221096 missense possibly damaging 0.93
R4924:Usf3 UTSW 16 44217355 missense probably benign
R5020:Usf3 UTSW 16 44215526 missense probably damaging 1.00
R5034:Usf3 UTSW 16 44216399 missense probably damaging 1.00
R5053:Usf3 UTSW 16 44217187 missense probably benign 0.01
R5058:Usf3 UTSW 16 44212707 missense probably damaging 1.00
R5164:Usf3 UTSW 16 44218180 missense probably damaging 1.00
R5391:Usf3 UTSW 16 44217463 missense probably benign 0.01
R5407:Usf3 UTSW 16 44217406 missense probably benign 0.01
R5536:Usf3 UTSW 16 44217370 missense probably benign 0.16
R5805:Usf3 UTSW 16 44220746 missense possibly damaging 0.50
R5966:Usf3 UTSW 16 44220859 missense probably benign 0.14
R6024:Usf3 UTSW 16 44219840 missense probably damaging 1.00
R6122:Usf3 UTSW 16 44217307 missense probably damaging 0.99
R6180:Usf3 UTSW 16 44221105 missense probably damaging 1.00
R6362:Usf3 UTSW 16 44218577 missense probably benign 0.01
R6579:Usf3 UTSW 16 44218834 missense possibly damaging 0.54
R6874:Usf3 UTSW 16 44219740 missense probably benign 0.00
R7226:Usf3 UTSW 16 44220005 missense possibly damaging 0.54
R7379:Usf3 UTSW 16 44220576 missense probably benign 0.33
R7389:Usf3 UTSW 16 44217941 missense probably benign 0.09
R7452:Usf3 UTSW 16 44220034 missense probably benign 0.00
R7606:Usf3 UTSW 16 44218943 missense probably damaging 1.00
R7750:Usf3 UTSW 16 44220521 missense probably benign 0.15
R7765:Usf3 UTSW 16 44219063 missense probably benign 0.28
R7830:Usf3 UTSW 16 44219779 nonsense probably null
R7895:Usf3 UTSW 16 44216202 missense possibly damaging 0.67
R7941:Usf3 UTSW 16 44215561 missense probably damaging 1.00
R8280:Usf3 UTSW 16 44218501 missense probably benign 0.00
R8421:Usf3 UTSW 16 44217209 missense possibly damaging 0.67
R8692:Usf3 UTSW 16 44219740 missense probably benign 0.00
R8798:Usf3 UTSW 16 44220173 missense probably damaging 0.99
R8824:Usf3 UTSW 16 44215613 missense probably benign 0.12
X0057:Usf3 UTSW 16 44220784 missense probably benign 0.32
X0066:Usf3 UTSW 16 44220427 missense probably benign 0.00
Z1176:Usf3 UTSW 16 44220431 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCCAAGGAATACACAGTGTGG -3'
(R):5'- GGCAACTGAAGAGTTAGCCTG -3'

Sequencing Primer
(F):5'- GGAATACACAGTGTGGTCCATCTTC -3'
(R):5'- ACTGAAGAGTTAGCCTGCCGTAC -3'
Posted On2020-07-28