Incidental Mutation 'R8286:Sfswap'
ID638453
Institutional Source Beutler Lab
Gene Symbol Sfswap
Ensembl Gene ENSMUSG00000029439
Gene Namesplicing factor SWAP
SynonymsSfrs8, 6330437E22Rik, 1190005N23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8286 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location129501221-129571384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129539719 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 409 (T409I)
Ref Sequence ENSEMBL: ENSMUSP00000062413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053737] [ENSMUST00000196698]
Predicted Effect probably damaging
Transcript: ENSMUST00000053737
AA Change: T409I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062413
Gene: ENSMUSG00000029439
AA Change: T409I

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 157 1.15e-57 SMART
low complexity region 160 170 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
SWAP 209 262 3.94e-19 SMART
low complexity region 286 293 N/A INTRINSIC
low complexity region 333 352 N/A INTRINSIC
low complexity region 397 441 N/A INTRINSIC
SWAP 456 507 9.55e-18 SMART
low complexity region 513 532 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 598 607 N/A INTRINSIC
coiled coil region 631 686 N/A INTRINSIC
low complexity region 741 788 N/A INTRINSIC
low complexity region 797 821 N/A INTRINSIC
low complexity region 840 865 N/A INTRINSIC
low complexity region 871 888 N/A INTRINSIC
low complexity region 889 905 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196698
SMART Domains Protein: ENSMUSP00000142464
Gene: ENSMUSG00000029439

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 121 1.8e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199215
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human homolog of Drosophila splicing regulatory protein. This gene autoregulates its expression by control of splicing of its first two introns. In addition, it also regulates the splicing of fibronectin and CD45 genes. Two transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit a wobbly phenotype with inner ear defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110035E14Rik C T 1: 9,613,388 T67I probably benign Het
4930402H24Rik T C 2: 130,717,328 I937V probably damaging Het
Abcb1b A T 5: 8,864,119 Y1163F probably damaging Het
Abcd4 A G 12: 84,603,146 V589A probably benign Het
Adam26b T A 8: 43,519,961 N668I probably benign Het
Atp2b2 T C 6: 113,842,314 N6S possibly damaging Het
BC021891 T A 8: 125,910,759 M28K probably benign Het
Cacna2d2 A G 9: 107,514,864 Y468C probably damaging Het
Cngb1 A T 8: 95,275,624 V52D Het
Cped1 A T 6: 22,254,602 Y998F probably benign Het
Csmd1 A G 8: 15,989,188 V2390A probably benign Het
Ctsj A T 13: 61,000,516 C321* probably null Het
Dip2a A C 10: 76,286,463 I139S probably benign Het
Eif1 A G 11: 100,319,969 probably benign Het
Exoc1 T C 5: 76,563,240 I662T probably benign Het
Flt4 A G 11: 49,637,262 R971G probably benign Het
Hecw2 T C 1: 53,840,769 T1294A probably damaging Het
Herc2 T G 7: 56,229,662 V4676G possibly damaging Het
Hif1a A G 12: 73,945,248 probably benign Het
Icam5 C A 9: 21,035,526 A450E possibly damaging Het
Mars C A 10: 127,305,479 R347L probably benign Het
Mctp1 A T 13: 76,757,055 I426F probably benign Het
Mdn1 T C 4: 32,731,960 S3007P possibly damaging Het
Mical3 T C 6: 121,021,188 R65G possibly damaging Het
Ncald G T 15: 37,397,261 Y58* probably null Het
Neil2 A T 14: 63,188,705 I72K probably benign Het
Olfr1056 A G 2: 86,356,347 F12L probably damaging Het
Olfr881 C A 9: 37,993,105 Y204* probably null Het
Pan2 A G 10: 128,318,320 D1086G probably damaging Het
Plxnb1 A G 9: 109,106,802 T1087A probably damaging Het
Prpf39 A G 12: 65,056,358 M469V probably benign Het
Ptprk A T 10: 28,568,327 S905C probably damaging Het
Rassf5 T C 1: 131,212,330 D164G possibly damaging Het
Setd1a T C 7: 127,786,184 W688R possibly damaging Het
Slc50a1 G A 3: 89,270,403 probably null Het
Slfn9 G C 11: 82,981,269 N880K probably damaging Het
Sprr1b T C 3: 92,437,413 K52R probably benign Het
Tfb2m T C 1: 179,529,205 D388G probably damaging Het
Tmem234 T C 4: 129,607,088 probably benign Het
Traj43 A G 14: 54,174,744 N1D Het
Trmt1l T A 1: 151,457,792 I682N probably damaging Het
Trp53rka T C 2: 165,491,525 D148G probably damaging Het
Vmn2r86 A G 10: 130,449,986 V440A probably benign Het
Wdfy3 C T 5: 101,937,421 V736I probably benign Het
Other mutations in Sfswap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Sfswap APN 5 129513233 missense probably damaging 1.00
IGL02064:Sfswap APN 5 129560796 missense probably benign 0.17
IGL02083:Sfswap APN 5 129539791 missense probably benign
IGL02378:Sfswap APN 5 129539604 missense probably damaging 1.00
FR4340:Sfswap UTSW 5 129569751 unclassified probably benign
FR4342:Sfswap UTSW 5 129569757 unclassified probably benign
FR4449:Sfswap UTSW 5 129569748 unclassified probably benign
FR4449:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569755 unclassified probably benign
FR4737:Sfswap UTSW 5 129569756 unclassified probably benign
FR4976:Sfswap UTSW 5 129569751 unclassified probably benign
I1329:Sfswap UTSW 5 129507137 unclassified probably benign
P0033:Sfswap UTSW 5 129539755 missense possibly damaging 0.60
R0184:Sfswap UTSW 5 129507189 missense probably damaging 0.97
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0414:Sfswap UTSW 5 129504051 missense possibly damaging 0.83
R0415:Sfswap UTSW 5 129504126 missense probably damaging 1.00
R0570:Sfswap UTSW 5 129503978 splice site probably benign
R1018:Sfswap UTSW 5 129554576 missense possibly damaging 0.91
R1173:Sfswap UTSW 5 129507143 critical splice acceptor site probably null
R1298:Sfswap UTSW 5 129541378 missense probably benign 0.14
R1723:Sfswap UTSW 5 129539694 missense probably benign
R1783:Sfswap UTSW 5 129513240 missense possibly damaging 0.92
R1828:Sfswap UTSW 5 129513084 missense probably damaging 1.00
R1879:Sfswap UTSW 5 129541328 missense probably benign 0.01
R2078:Sfswap UTSW 5 129516107 missense possibly damaging 0.81
R2349:Sfswap UTSW 5 129569738 missense possibly damaging 0.87
R3757:Sfswap UTSW 5 129513234 missense probably damaging 1.00
R4093:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4094:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4095:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4785:Sfswap UTSW 5 129513083 missense probably damaging 1.00
R5139:Sfswap UTSW 5 129571009 missense possibly damaging 0.73
R5355:Sfswap UTSW 5 129539746 missense probably benign 0.09
R5481:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5600:Sfswap UTSW 5 129513158 missense probably damaging 1.00
R5686:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5906:Sfswap UTSW 5 129542043 missense probably benign 0.22
R6332:Sfswap UTSW 5 129571041 missense possibly damaging 0.91
R6738:Sfswap UTSW 5 129541441 missense probably damaging 0.98
R6743:Sfswap UTSW 5 129550819 nonsense probably null
R7371:Sfswap UTSW 5 129543241 missense probably benign 0.01
R7747:Sfswap UTSW 5 129550593 splice site probably null
R8738:Sfswap UTSW 5 129543281 missense possibly damaging 0.52
RF003:Sfswap UTSW 5 129569764 unclassified probably benign
RF042:Sfswap UTSW 5 129569743 unclassified probably benign
RF049:Sfswap UTSW 5 129569744 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCTGTTCATACTGTGGTGGAAC -3'
(R):5'- GATGCAGGTCTGTGATCCAG -3'

Sequencing Primer
(F):5'- GACATTGTAGCTGGCTCACCTG -3'
(R):5'- TCTGTGATCCAGATGAAGAACACTG -3'
Posted On2020-07-28