Incidental Mutation 'R0708:Brdt'
ID 63846
Institutional Source Beutler Lab
Gene Symbol Brdt
Ensembl Gene ENSMUSG00000029279
Gene Name bromodomain, testis-specific
Synonyms Fsrg3, 7420412D09Rik, Brd6
MMRRC Submission 038891-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0708 (G1)
Quality Score 121
Status Not validated
Chromosome 5
Chromosomal Location 107331159-107387058 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 107358900 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 450 (K450*)
Ref Sequence ENSEMBL: ENSMUSP00000031215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031215]
AlphaFold Q91Y44
PDB Structure Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000031215
AA Change: K450*
SMART Domains Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: K450*

DomainStartEndE-ValueType
BROMO 24 134 2.7e-45 SMART
BROMO 268 377 2.18e-40 SMART
low complexity region 392 417 N/A INTRINSIC
low complexity region 446 455 N/A INTRINSIC
low complexity region 472 500 N/A INTRINSIC
Pfam:BET 505 569 9.2e-34 PFAM
low complexity region 585 603 N/A INTRINSIC
low complexity region 649 691 N/A INTRINSIC
low complexity region 895 909 N/A INTRINSIC
Pfam:BRD4_CDT 913 956 3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162804
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Col9a1 A T 1: 24,237,261 Q750L possibly damaging Het
Dnah6 A T 6: 73,212,622 S14R probably benign Het
Enox1 A G 14: 77,592,912 N319S probably benign Het
Frs2 G A 10: 117,074,092 T455M probably damaging Het
Glra3 C T 8: 56,125,364 probably benign Het
Gmppa T C 1: 75,442,574 F375S probably damaging Het
Hectd4 G A 5: 121,286,463 probably null Het
Hgf C A 5: 16,566,763 C129* probably null Het
Insc T A 7: 114,845,146 V456E probably damaging Het
Ints14 G A 9: 64,983,984 V416I probably benign Het
Klk1b11 T C 7: 43,997,728 F29L possibly damaging Het
Ogfod1 C T 8: 94,039,045 L79F possibly damaging Het
Olfr926 T A 9: 38,877,275 V33E probably damaging Het
Orc3 A T 4: 34,597,368 I224N probably damaging Het
Papss2 T C 19: 32,637,216 F111L probably damaging Het
Poc1b A G 10: 99,155,130 D291G probably null Het
Prl8a8 A T 13: 27,511,545 M72K possibly damaging Het
Ptpn7 C A 1: 135,134,547 T77K probably damaging Het
Ptpro T C 6: 137,386,253 S462P probably benign Het
Rab3gap2 T A 1: 185,249,926 S392T probably damaging Het
Sema4d A G 13: 51,712,719 V245A probably benign Het
Sgcb A T 5: 73,640,882 probably null Het
Slc24a1 T A 9: 64,947,890 K578N unknown Het
Sptbn1 A T 11: 30,114,739 V1920E probably damaging Het
Tecr A T 8: 83,573,109 I101N probably damaging Het
Tectb T C 19: 55,191,552 F277L probably benign Het
Tgs1 T A 4: 3,586,152 L343H probably benign Het
Thbs4 C A 13: 92,773,186 G368W probably damaging Het
Zfp558 T C 9: 18,456,827 S222G possibly damaging Het
Other mutations in Brdt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02342:Brdt APN 5 107342203 missense probably damaging 1.00
IGL02718:Brdt APN 5 107350068 splice site probably benign
IGL02746:Brdt APN 5 107370324 missense probably benign
IGL02851:Brdt APN 5 107377995 missense possibly damaging 0.47
R0585:Brdt UTSW 5 107356882 critical splice donor site probably null
R1338:Brdt UTSW 5 107350188 missense probably benign 0.02
R1710:Brdt UTSW 5 107343584 missense probably damaging 1.00
R1794:Brdt UTSW 5 107359853 small deletion probably benign
R1861:Brdt UTSW 5 107359458 missense probably benign
R1913:Brdt UTSW 5 107348613 missense probably benign
R2029:Brdt UTSW 5 107359224 missense probably benign 0.35
R2431:Brdt UTSW 5 107378015 splice site probably null
R3121:Brdt UTSW 5 107377145 missense probably damaging 0.99
R3122:Brdt UTSW 5 107377145 missense probably damaging 0.99
R4258:Brdt UTSW 5 107359909 missense probably damaging 0.97
R4609:Brdt UTSW 5 107359936 missense probably benign 0.00
R5306:Brdt UTSW 5 107345144 missense probably damaging 1.00
R5640:Brdt UTSW 5 107359308 nonsense probably null
R5677:Brdt UTSW 5 107348617 missense possibly damaging 0.85
R5936:Brdt UTSW 5 107359395 missense probably damaging 1.00
R6145:Brdt UTSW 5 107377999 missense possibly damaging 0.67
R6261:Brdt UTSW 5 107348503 missense probably benign 0.04
R6408:Brdt UTSW 5 107385492 missense probably damaging 1.00
R6930:Brdt UTSW 5 107359215 missense probably benign 0.35
R7372:Brdt UTSW 5 107370294 missense possibly damaging 0.49
R7741:Brdt UTSW 5 107358886 missense probably benign 0.00
R7842:Brdt UTSW 5 107348588 missense possibly damaging 0.49
R7869:Brdt UTSW 5 107370179 missense probably benign 0.04
R7887:Brdt UTSW 5 107359933 missense possibly damaging 0.66
R7972:Brdt UTSW 5 107348549 missense possibly damaging 0.53
R8064:Brdt UTSW 5 107377996 nonsense probably null
R8958:Brdt UTSW 5 107378011 missense probably benign
R9199:Brdt UTSW 5 107350163 nonsense probably null
R9346:Brdt UTSW 5 107377014 missense probably damaging 0.99
X0011:Brdt UTSW 5 107342128 missense probably damaging 0.96
X0011:Brdt UTSW 5 107377092 missense probably damaging 1.00
Z1176:Brdt UTSW 5 107359898 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CATGAATTTCACAAAGGGTGGCATGAC -3'
(R):5'- CCTCTTCCGATTTCAAAAGCGGC -3'

Sequencing Primer
(F):5'- CAAAGGGTGGCATGACTTTGG -3'
(R):5'- TTGATCCAGGCCCTCACATAG -3'
Posted On 2013-07-30