Incidental Mutation 'R8286:Prpf39'
ID 638474
Institutional Source Beutler Lab
Gene Symbol Prpf39
Ensembl Gene ENSMUSG00000035597
Gene Name pre-mRNA processing factor 39
Synonyms Srcs1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock # R8286 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 65036333-65063386 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65056358 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 469 (M469V)
Ref Sequence ENSEMBL: ENSMUSP00000112953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120580] [ENSMUST00000129956]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000120580
AA Change: M469V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112953
Gene: ENSMUSG00000035597
AA Change: M469V

DomainStartEndE-ValueType
HAT 107 139 3.71e-2 SMART
HAT 141 173 4.39e-4 SMART
HAT 181 216 2.07e0 SMART
HAT 218 251 1.36e2 SMART
low complexity region 277 290 N/A INTRINSIC
Blast:HAT 323 363 6e-18 BLAST
HAT 365 397 3.2e-6 SMART
HAT 398 431 3.21e1 SMART
HAT 505 537 3.63e1 SMART
low complexity region 645 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129956
SMART Domains Protein: ENSMUSP00000114713
Gene: ENSMUSG00000035597

DomainStartEndE-ValueType
Blast:HAT 107 139 7e-17 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110035E14Rik C T 1: 9,613,388 T67I probably benign Het
4930402H24Rik T C 2: 130,717,328 I937V probably damaging Het
Abcb1b A T 5: 8,864,119 Y1163F probably damaging Het
Abcd4 A G 12: 84,603,146 V589A probably benign Het
Adam26b T A 8: 43,519,961 N668I probably benign Het
Atp2b2 T C 6: 113,842,314 N6S possibly damaging Het
BC021891 T A 8: 125,910,759 M28K probably benign Het
Cacna2d2 A G 9: 107,514,864 Y468C probably damaging Het
Cngb1 A T 8: 95,275,624 V52D Het
Cped1 A T 6: 22,254,602 Y998F probably benign Het
Csmd1 A G 8: 15,989,188 V2390A probably benign Het
Ctsj A T 13: 61,000,516 C321* probably null Het
Dip2a A C 10: 76,286,463 I139S probably benign Het
Eif1 A G 11: 100,319,969 probably benign Het
Exoc1 T C 5: 76,563,240 I662T probably benign Het
Flt4 A G 11: 49,637,262 R971G probably benign Het
Hecw2 T C 1: 53,840,769 T1294A probably damaging Het
Herc2 T G 7: 56,229,662 V4676G possibly damaging Het
Hif1a A G 12: 73,945,248 probably benign Het
Icam5 C A 9: 21,035,526 A450E possibly damaging Het
Mars C A 10: 127,305,479 R347L probably benign Het
Mctp1 A T 13: 76,757,055 I426F probably benign Het
Mdn1 T C 4: 32,731,960 S3007P possibly damaging Het
Mical3 T C 6: 121,021,188 R65G possibly damaging Het
Ncald G T 15: 37,397,261 Y58* probably null Het
Neil2 A T 14: 63,188,705 I72K probably benign Het
Olfr1056 A G 2: 86,356,347 F12L probably damaging Het
Olfr881 C A 9: 37,993,105 Y204* probably null Het
Pan2 A G 10: 128,318,320 D1086G probably damaging Het
Plxnb1 A G 9: 109,106,802 T1087A probably damaging Het
Ptprk A T 10: 28,568,327 S905C probably damaging Het
Rassf5 T C 1: 131,212,330 D164G possibly damaging Het
Setd1a T C 7: 127,786,184 W688R possibly damaging Het
Sfswap C T 5: 129,539,719 T409I probably damaging Het
Slc50a1 G A 3: 89,270,403 probably null Het
Slfn9 G C 11: 82,981,269 N880K probably damaging Het
Sprr1b T C 3: 92,437,413 K52R probably benign Het
Tfb2m T C 1: 179,529,205 D388G probably damaging Het
Tmem234 T C 4: 129,607,088 probably benign Het
Traj43 A G 14: 54,174,744 N1D Het
Trmt1l T A 1: 151,457,792 I682N probably damaging Het
Trp53rka T C 2: 165,491,525 D148G probably damaging Het
Vmn2r86 A G 10: 130,449,986 V440A probably benign Het
Wdfy3 C T 5: 101,937,421 V736I probably benign Het
Other mutations in Prpf39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Prpf39 APN 12 65043263 missense probably damaging 0.99
IGL01025:Prpf39 APN 12 65042481 unclassified probably benign
IGL01323:Prpf39 APN 12 65042724 missense possibly damaging 0.70
IGL02346:Prpf39 APN 12 65057736 missense probably benign 0.02
IGL02966:Prpf39 APN 12 65042779 missense probably benign 0.45
IGL03189:Prpf39 APN 12 65043302 nonsense probably null
IGL03357:Prpf39 APN 12 65061437 unclassified probably benign
R0103:Prpf39 UTSW 12 65055283 missense possibly damaging 0.56
R0103:Prpf39 UTSW 12 65055283 missense possibly damaging 0.56
R0328:Prpf39 UTSW 12 65043371 splice site probably benign
R0549:Prpf39 UTSW 12 65056256 missense probably benign 0.05
R0840:Prpf39 UTSW 12 65048206 missense probably benign 0.21
R1248:Prpf39 UTSW 12 65053966 splice site probably benign
R1322:Prpf39 UTSW 12 65042662 missense possibly damaging 0.48
R1481:Prpf39 UTSW 12 65053314 missense probably damaging 1.00
R2209:Prpf39 UTSW 12 65057915 critical splice donor site probably null
R2232:Prpf39 UTSW 12 65044012 nonsense probably null
R2507:Prpf39 UTSW 12 65057815 missense probably benign 0.36
R2508:Prpf39 UTSW 12 65057815 missense probably benign 0.36
R2959:Prpf39 UTSW 12 65042523 missense probably damaging 1.00
R3117:Prpf39 UTSW 12 65057877 missense possibly damaging 0.79
R3118:Prpf39 UTSW 12 65057877 missense possibly damaging 0.79
R3980:Prpf39 UTSW 12 65061457 unclassified probably benign
R4407:Prpf39 UTSW 12 65056266 missense probably damaging 1.00
R4620:Prpf39 UTSW 12 65042563 missense probably benign
R4926:Prpf39 UTSW 12 65044056 missense possibly damaging 0.90
R5154:Prpf39 UTSW 12 65048277 missense probably benign 0.29
R6248:Prpf39 UTSW 12 65042754 missense probably damaging 1.00
R6334:Prpf39 UTSW 12 65042813 splice site probably null
R6614:Prpf39 UTSW 12 65042563 missense probably benign
R6749:Prpf39 UTSW 12 65056274 missense possibly damaging 0.94
R6944:Prpf39 UTSW 12 65042680 missense probably benign 0.03
R7023:Prpf39 UTSW 12 65053300 missense possibly damaging 0.94
R7503:Prpf39 UTSW 12 65053393 missense probably benign 0.04
R7532:Prpf39 UTSW 12 65053371 missense probably benign 0.00
R7608:Prpf39 UTSW 12 65053446 missense probably benign 0.41
R8439:Prpf39 UTSW 12 65055262 missense possibly damaging 0.95
R8787:Prpf39 UTSW 12 65042781 missense possibly damaging 0.95
R9101:Prpf39 UTSW 12 65043304 missense probably damaging 1.00
R9153:Prpf39 UTSW 12 65059897 missense probably damaging 0.99
R9448:Prpf39 UTSW 12 65061260 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATCTAGACTGCAGGCTAATG -3'
(R):5'- TCATCACAGTTGCCAAAGGG -3'

Sequencing Primer
(F):5'- CTAGACTGCAGGCTAATGTTTTTC -3'
(R):5'- TCACAGTTGCCAAAGGGAAAAAGTAC -3'
Posted On 2020-07-28