Incidental Mutation 'R8287:Fcrlb'
ID638482
Institutional Source Beutler Lab
Gene Symbol Fcrlb
Ensembl Gene ENSMUSG00000070524
Gene NameFc receptor-like B
SynonymsFcry, FREB2, FREB-2, mFCRL2, FcRL2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8287 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location170907273-170912941 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 170912084 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 83 (Y83F)
Ref Sequence ENSEMBL: ENSMUSP00000091895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094337]
Predicted Effect probably damaging
Transcript: ENSMUST00000094337
AA Change: Y83F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091895
Gene: ENSMUSG00000070524
AA Change: Y83F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG_like 29 101 1.17e1 SMART
IG 109 191 9.34e-4 SMART
Blast:IG_like 209 281 2e-38 BLAST
low complexity region 290 306 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FCRL2 belongs to the Fc receptor family. Fc receptors are involved in phagocytosis, antibody-dependent cell cytotoxicity, immediate hypersensitivity, and transcytosis of immunoglobulins via their ability to bind immunoglobulin (Ig) constant regions (Chikaev et al., 2005 [PubMed 15676285]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit an enhanced antibody response to a T-dependent antigen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,174,078 probably null Het
Apcs T G 1: 172,894,247 L177F possibly damaging Het
Arsa G T 15: 89,473,390 H457N probably benign Het
Blnk T C 19: 40,929,291 Y419C probably damaging Het
Cdon A G 9: 35,463,929 D417G probably benign Het
Cntnap4 T C 8: 112,859,143 S1133P probably damaging Het
Cops2 T A 2: 125,859,117 probably benign Het
Cyp2c40 T A 19: 39,767,455 M472L probably damaging Het
Dlg5 T A 14: 24,164,385 Q379L probably benign Het
Dnah12 A G 14: 26,812,603 I2019V probably benign Het
Dock7 T C 4: 98,977,920 Y1241C unknown Het
Dock8 T C 19: 25,130,461 Y852H probably damaging Het
Foxj2 G A 6: 122,828,267 A33T possibly damaging Het
Gcnt2 T C 13: 40,860,632 F93S probably damaging Het
Gm14180 A G 11: 99,734,242 S17P unknown Het
Gucy1b2 T C 14: 62,411,816 Q437R probably damaging Het
Hyou1 A G 9: 44,388,133 D707G probably benign Het
Ncam2 A G 16: 81,526,995 Q509R probably benign Het
Npsr1 T C 9: 24,289,962 V214A probably damaging Het
Olfr919 T C 9: 38,698,337 T14A probably benign Het
Speg T A 1: 75,422,236 M2109K probably benign Het
Stxbp5 T C 10: 9,784,385 H722R probably benign Het
Vmn2r19 A G 6: 123,331,629 N555S probably damaging Het
Xrcc1 G A 7: 24,572,278 R562H probably damaging Het
Zscan18 T G 7: 12,775,371 K67N unknown Het
Other mutations in Fcrlb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Fcrlb APN 1 170908824 missense possibly damaging 0.81
IGL02124:Fcrlb APN 1 170907358 missense probably benign 0.15
IGL02142:Fcrlb APN 1 170908679 missense probably damaging 1.00
IGL02385:Fcrlb APN 1 170907599 missense probably damaging 0.99
R0928:Fcrlb UTSW 1 170907940 missense possibly damaging 0.87
R1460:Fcrlb UTSW 1 170912284 splice site probably benign
R1735:Fcrlb UTSW 1 170907332 missense probably benign
R1806:Fcrlb UTSW 1 170907527 missense probably benign 0.01
R2078:Fcrlb UTSW 1 170908081 missense probably damaging 1.00
R3806:Fcrlb UTSW 1 170907614 missense probably benign 0.00
R4570:Fcrlb UTSW 1 170912620 critical splice donor site probably null
R5457:Fcrlb UTSW 1 170912157 missense probably damaging 0.99
R5854:Fcrlb UTSW 1 170907961 missense probably damaging 1.00
R6233:Fcrlb UTSW 1 170908889 missense probably damaging 1.00
R7502:Fcrlb UTSW 1 170908641 missense probably damaging 0.98
R7579:Fcrlb UTSW 1 170907847 splice site probably null
R7879:Fcrlb UTSW 1 170908796 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGGCTTTTGGACCAGGAAATC -3'
(R):5'- TACTCTGGAGAAGCCTGTACTG -3'

Sequencing Primer
(F):5'- GGAAATCTTTACTGCAGGCTTC -3'
(R):5'- TGGAGAAGCCTGTACTGACTCTAC -3'
Posted On2020-07-28