Incidental Mutation 'R8287:Apcs'
ID638483
Institutional Source Beutler Lab
Gene Symbol Apcs
Ensembl Gene ENSMUSG00000026542
Gene Nameserum amyloid P-component
SynonymsSap
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R8287 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location172893961-172895041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 172894247 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 177 (L177F)
Ref Sequence ENSEMBL: ENSMUSP00000027824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027824]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027824
AA Change: L177F

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027824
Gene: ENSMUSG00000026542
AA Change: L177F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PTX 21 224 2.27e-132 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein, belonging to the pentraxin family of proteins, which has a characteristic pentameric organization. These family members have considerable sequence homology which is thought to be the result of gene duplication. The binding of the encoded protein to proteins in the pathological amyloid cross-beta fold suggests its possible role as a chaperone. This protein is also thought to control the degradation of chromatin. It has been demonstrated that this protein binds to apoptotic cells at an early stage, which raises the possibility that it is involved in dealing with apoptotic cells in vivo. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased antibody productions, increased autoimmune antibodies, reduced amyloidosis and glomerulonephrosis depending on strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,174,078 probably null Het
Arsa G T 15: 89,473,390 H457N probably benign Het
Blnk T C 19: 40,929,291 Y419C probably damaging Het
Cdon A G 9: 35,463,929 D417G probably benign Het
Cntnap4 T C 8: 112,859,143 S1133P probably damaging Het
Cops2 T A 2: 125,859,117 probably benign Het
Cyp2c40 T A 19: 39,767,455 M472L probably damaging Het
Dlg5 T A 14: 24,164,385 Q379L probably benign Het
Dnah12 A G 14: 26,812,603 I2019V probably benign Het
Dock7 T C 4: 98,977,920 Y1241C unknown Het
Dock8 T C 19: 25,130,461 Y852H probably damaging Het
Fcrlb T A 1: 170,912,084 Y83F probably damaging Het
Foxj2 G A 6: 122,828,267 A33T possibly damaging Het
Gcnt2 T C 13: 40,860,632 F93S probably damaging Het
Gm14180 A G 11: 99,734,242 S17P unknown Het
Gucy1b2 T C 14: 62,411,816 Q437R probably damaging Het
Hyou1 A G 9: 44,388,133 D707G probably benign Het
Ncam2 A G 16: 81,526,995 Q509R probably benign Het
Npsr1 T C 9: 24,289,962 V214A probably damaging Het
Olfr919 T C 9: 38,698,337 T14A probably benign Het
Speg T A 1: 75,422,236 M2109K probably benign Het
Stxbp5 T C 10: 9,784,385 H722R probably benign Het
Vmn2r19 A G 6: 123,331,629 N555S probably damaging Het
Xrcc1 G A 7: 24,572,278 R562H probably damaging Het
Zscan18 T G 7: 12,775,371 K67N unknown Het
Other mutations in Apcs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Apcs APN 1 172894467 missense probably damaging 0.97
R0040:Apcs UTSW 1 172894456 missense probably benign
R0040:Apcs UTSW 1 172894456 missense probably benign
R0865:Apcs UTSW 1 172894215 missense probably benign 0.30
R1691:Apcs UTSW 1 172894593 missense probably damaging 1.00
R2158:Apcs UTSW 1 172894533 missense probably damaging 1.00
R3411:Apcs UTSW 1 172894563 missense probably damaging 1.00
R3949:Apcs UTSW 1 172894692 missense probably damaging 1.00
R4636:Apcs UTSW 1 172894422 missense probably damaging 1.00
R6911:Apcs UTSW 1 172894185 missense probably benign 0.02
R7218:Apcs UTSW 1 172894664 missense possibly damaging 0.85
R8143:Apcs UTSW 1 172894333 missense probably damaging 1.00
RF005:Apcs UTSW 1 172894242 missense probably damaging 1.00
RF024:Apcs UTSW 1 172894242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAATTCTGCTGCCTTGAC -3'
(R):5'- ATGTACCACTTGGGAGTCCTC -3'

Sequencing Primer
(F):5'- ATCGGCCATCTGATGTCCATGAG -3'
(R):5'- GGAGTCCTCCTCTGGCATTG -3'
Posted On2020-07-28