Incidental Mutation 'R8287:Cops2'
ID638484
Institutional Source Beutler Lab
Gene Symbol Cops2
Ensembl Gene ENSMUSG00000027206
Gene NameCOP9 signalosome subunit 2
SynonymsSgn2, alien-like, alien homologue, Csn2, Trip15
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8287 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location125830304-125859139 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 125859117 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028635] [ENSMUST00000028636] [ENSMUST00000110462] [ENSMUST00000110463] [ENSMUST00000125084]
Predicted Effect probably benign
Transcript: ENSMUST00000028635
SMART Domains Protein: ENSMUSP00000028635
Gene: ENSMUSG00000027206

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
PAM 169 343 1.08e-64 SMART
PINT 345 427 4.24e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028636
SMART Domains Protein: ENSMUSP00000028636
Gene: ENSMUSG00000027207

DomainStartEndE-ValueType
Pfam:GalKase_gal_bdg 13 62 3.8e-26 PFAM
Pfam:GHMP_kinases_N 120 187 1e-15 PFAM
Pfam:GHMP_kinases_C 333 419 6.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110462
SMART Domains Protein: ENSMUSP00000106089
Gene: ENSMUSG00000027206

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
PAM 140 302 1.59e-30 SMART
PINT 304 386 4.24e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110463
SMART Domains Protein: ENSMUSP00000106090
Gene: ENSMUSG00000027206

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
PAM 176 350 1.08e-64 SMART
PINT 352 434 4.24e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125084
SMART Domains Protein: ENSMUSP00000119902
Gene: ENSMUSG00000027207

DomainStartEndE-ValueType
Pfam:GalKase_gal_bdg 1 50 7.7e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos very soon after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,174,078 probably null Het
Apcs T G 1: 172,894,247 L177F possibly damaging Het
Arsa G T 15: 89,473,390 H457N probably benign Het
Blnk T C 19: 40,929,291 Y419C probably damaging Het
Cdon A G 9: 35,463,929 D417G probably benign Het
Cntnap4 T C 8: 112,859,143 S1133P probably damaging Het
Cyp2c40 T A 19: 39,767,455 M472L probably damaging Het
Dlg5 T A 14: 24,164,385 Q379L probably benign Het
Dnah12 A G 14: 26,812,603 I2019V probably benign Het
Dock7 T C 4: 98,977,920 Y1241C unknown Het
Dock8 T C 19: 25,130,461 Y852H probably damaging Het
Fcrlb T A 1: 170,912,084 Y83F probably damaging Het
Foxj2 G A 6: 122,828,267 A33T possibly damaging Het
Gcnt2 T C 13: 40,860,632 F93S probably damaging Het
Gm14180 A G 11: 99,734,242 S17P unknown Het
Gucy1b2 T C 14: 62,411,816 Q437R probably damaging Het
Hyou1 A G 9: 44,388,133 D707G probably benign Het
Ncam2 A G 16: 81,526,995 Q509R probably benign Het
Npsr1 T C 9: 24,289,962 V214A probably damaging Het
Olfr919 T C 9: 38,698,337 T14A probably benign Het
Speg T A 1: 75,422,236 M2109K probably benign Het
Stxbp5 T C 10: 9,784,385 H722R probably benign Het
Vmn2r19 A G 6: 123,331,629 N555S probably damaging Het
Xrcc1 G A 7: 24,572,278 R562H probably damaging Het
Zscan18 T G 7: 12,775,371 K67N unknown Het
Other mutations in Cops2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Cops2 APN 2 125832243 missense probably benign
IGL02496:Cops2 APN 2 125836243 splice site probably benign
IGL02678:Cops2 APN 2 125844911 missense probably benign 0.30
IGL02930:Cops2 APN 2 125832189 utr 3 prime probably benign
R4634:Cops2 UTSW 2 125840480 missense probably damaging 1.00
R6344:Cops2 UTSW 2 125858979 unclassified probably benign
R8038:Cops2 UTSW 2 125832286 missense probably benign 0.00
R8297:Cops2 UTSW 2 125859108 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGGTCGTAGTCCTCCTCATC -3'
(R):5'- AACAGACGGTTCCAGAGTCC -3'

Sequencing Primer
(F):5'- TCATCGCACATGAAATCATCCTC -3'
(R):5'- TCACCTAGGACGCTGGATAC -3'
Posted On2020-07-28