Incidental Mutation 'R8287:Foxj2'
ID638486
Institutional Source Beutler Lab
Gene Symbol Foxj2
Ensembl Gene ENSMUSG00000003154
Gene Nameforkhead box J2
SynonymsFhx
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R8287 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location122819914-122845366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122828267 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 33 (A33T)
Ref Sequence ENSEMBL: ENSMUSP00000003238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003238] [ENSMUST00000177927] [ENSMUST00000203075]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003238
AA Change: A33T

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003238
Gene: ENSMUSG00000003154
AA Change: A33T

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
FH 64 153 1.77e-47 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 266 275 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 359 393 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177927
AA Change: A33T

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137645
Gene: ENSMUSG00000003154
AA Change: A33T

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
FH 64 153 1.77e-47 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 266 275 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 359 393 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203075
AA Change: A33T

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145438
Gene: ENSMUSG00000003154
AA Change: A33T

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
FH 64 153 7.8e-50 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,174,078 probably null Het
Apcs T G 1: 172,894,247 L177F possibly damaging Het
Arsa G T 15: 89,473,390 H457N probably benign Het
Blnk T C 19: 40,929,291 Y419C probably damaging Het
Cdon A G 9: 35,463,929 D417G probably benign Het
Cntnap4 T C 8: 112,859,143 S1133P probably damaging Het
Cops2 T A 2: 125,859,117 probably benign Het
Cyp2c40 T A 19: 39,767,455 M472L probably damaging Het
Dlg5 T A 14: 24,164,385 Q379L probably benign Het
Dnah12 A G 14: 26,812,603 I2019V probably benign Het
Dock7 T C 4: 98,977,920 Y1241C unknown Het
Dock8 T C 19: 25,130,461 Y852H probably damaging Het
Fcrlb T A 1: 170,912,084 Y83F probably damaging Het
Gcnt2 T C 13: 40,860,632 F93S probably damaging Het
Gm14180 A G 11: 99,734,242 S17P unknown Het
Gucy1b2 T C 14: 62,411,816 Q437R probably damaging Het
Hyou1 A G 9: 44,388,133 D707G probably benign Het
Ncam2 A G 16: 81,526,995 Q509R probably benign Het
Npsr1 T C 9: 24,289,962 V214A probably damaging Het
Olfr919 T C 9: 38,698,337 T14A probably benign Het
Speg T A 1: 75,422,236 M2109K probably benign Het
Stxbp5 T C 10: 9,784,385 H722R probably benign Het
Vmn2r19 A G 6: 123,331,629 N555S probably damaging Het
Xrcc1 G A 7: 24,572,278 R562H probably damaging Het
Zscan18 T G 7: 12,775,371 K67N unknown Het
Other mutations in Foxj2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Foxj2 APN 6 122839635 missense probably damaging 1.00
IGL01100:Foxj2 APN 6 122828391 missense probably damaging 1.00
IGL02169:Foxj2 APN 6 122828466 missense probably damaging 0.98
IGL02220:Foxj2 APN 6 122838581 splice site probably benign
IGL02423:Foxj2 APN 6 122842773 missense possibly damaging 0.90
IGL03026:Foxj2 APN 6 122838180 missense probably benign 0.38
IGL03198:Foxj2 APN 6 122833007 critical splice donor site probably null
R0400:Foxj2 UTSW 6 122833808 missense possibly damaging 0.69
R1572:Foxj2 UTSW 6 122833261 missense probably benign 0.00
R2063:Foxj2 UTSW 6 122840241 missense probably benign 0.01
R2568:Foxj2 UTSW 6 122828372 missense probably damaging 1.00
R2877:Foxj2 UTSW 6 122842832 missense probably damaging 0.96
R4745:Foxj2 UTSW 6 122837989 missense probably damaging 1.00
R4763:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R4764:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R4765:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R4775:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R5056:Foxj2 UTSW 6 122833874 missense probably benign 0.00
R5816:Foxj2 UTSW 6 122833736 missense probably benign
R6254:Foxj2 UTSW 6 122838139 missense probably damaging 0.98
R6265:Foxj2 UTSW 6 122828174 missense probably damaging 0.99
R6540:Foxj2 UTSW 6 122833243 missense probably benign
R6882:Foxj2 UTSW 6 122828505 critical splice donor site probably null
R6981:Foxj2 UTSW 6 122828444 missense probably damaging 1.00
R6981:Foxj2 UTSW 6 122842839 missense probably benign 0.14
R7295:Foxj2 UTSW 6 122840231 missense probably benign 0.14
R7475:Foxj2 UTSW 6 122837842 missense probably benign 0.14
R8075:Foxj2 UTSW 6 122838096 nonsense probably null
R8320:Foxj2 UTSW 6 122833690 missense probably benign 0.05
R8511:Foxj2 UTSW 6 122831445 nonsense probably null
Z1176:Foxj2 UTSW 6 122832936 critical splice acceptor site probably null
Z1176:Foxj2 UTSW 6 122833711 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTAACAGGGCTGGTGAGATG -3'
(R):5'- AGAGTCATCTTCTTAGCTGGGG -3'

Sequencing Primer
(F):5'- CTGAAGACAGCTGCAGTGTACTTAC -3'
(R):5'- CATCTTCTTAGCTGGGGAGGAG -3'
Posted On2020-07-28