Incidental Mutation 'R8287:Olfr919'
ID638493
Institutional Source Beutler Lab
Gene Symbol Olfr919
Ensembl Gene ENSMUSG00000056961
Gene Nameolfactory receptor 919
SynonymsMOR171-23, GA_x6K02T2PVTD-32400678-32399743
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R8287 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38696804-38703673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38698337 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 14 (T14A)
Ref Sequence ENSEMBL: ENSMUSP00000071372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071425]
Predicted Effect probably benign
Transcript: ENSMUST00000071425
AA Change: T14A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000071372
Gene: ENSMUSG00000056961
AA Change: T14A

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 9.8e-50 PFAM
Pfam:7tm_1 45 294 9e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (27/27)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,174,078 probably null Het
Apcs T G 1: 172,894,247 L177F possibly damaging Het
Arsa G T 15: 89,473,390 H457N probably benign Het
Atg10 A T 13: 91,022,680 probably benign Het
Blnk T C 19: 40,929,291 Y419C probably damaging Het
Cdon A G 9: 35,463,929 D417G probably benign Het
Cntnap4 T C 8: 112,859,143 S1133P probably damaging Het
Cops2 T A 2: 125,859,117 probably benign Het
Cyp2c40 T A 19: 39,767,455 M472L probably damaging Het
Dlg5 T A 14: 24,164,385 Q379L probably benign Het
Dnah12 A G 14: 26,812,603 I2019V probably benign Het
Dock7 T C 4: 98,977,920 Y1241C unknown Het
Dock8 T C 19: 25,130,461 Y852H probably damaging Het
Fcrlb T A 1: 170,912,084 Y83F probably damaging Het
Foxj2 G A 6: 122,828,267 A33T possibly damaging Het
Gcnt2 T C 13: 40,860,632 F93S probably damaging Het
Gm14180 A G 11: 99,734,242 S17P unknown Het
Gucy1b2 T C 14: 62,411,816 Q437R probably damaging Het
Hyou1 A G 9: 44,388,133 D707G probably benign Het
Ncam2 A G 16: 81,526,995 Q509R probably benign Het
Npsr1 T C 9: 24,289,962 V214A probably damaging Het
Slc50a1 G A 3: 89,270,403 probably benign Het
Speg T A 1: 75,422,236 M2109K probably benign Het
Stxbp5 T C 10: 9,784,385 H722R probably benign Het
Vmn2r19 A G 6: 123,331,629 N555S probably damaging Het
Xrcc1 G A 7: 24,572,278 R562H probably damaging Het
Zscan18 T G 7: 12,775,371 K67N unknown Het
Other mutations in Olfr919
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Olfr919 APN 9 38697905 missense probably benign 0.00
IGL02515:Olfr919 APN 9 38697791 missense probably benign 0.39
IGL02745:Olfr919 APN 9 38698198 missense probably damaging 0.99
H8562:Olfr919 UTSW 9 38697910 missense probably damaging 1.00
R1960:Olfr919 UTSW 9 38698204 missense probably benign 0.28
R1973:Olfr919 UTSW 9 38697868 missense probably damaging 0.96
R3119:Olfr919 UTSW 9 38697659 nonsense probably null
R4543:Olfr919 UTSW 9 38697545 missense possibly damaging 0.93
R4752:Olfr919 UTSW 9 38697970 missense probably damaging 0.99
R5474:Olfr919 UTSW 9 38698313 missense possibly damaging 0.69
R5532:Olfr919 UTSW 9 38697647 missense probably damaging 1.00
R5635:Olfr919 UTSW 9 38698159 missense possibly damaging 0.64
R5940:Olfr919 UTSW 9 38697711 nonsense probably null
R6820:Olfr919 UTSW 9 38697475 missense possibly damaging 0.88
R7164:Olfr919 UTSW 9 38698219 missense possibly damaging 0.95
R7337:Olfr919 UTSW 9 38697865 missense probably benign 0.12
R7806:Olfr919 UTSW 9 38698271 missense probably benign 0.39
Z1176:Olfr919 UTSW 9 38697928 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GTCAATGAAGGACAGGCTGCTG -3'
(R):5'- CTGTTCATTGGATGTTCATGGAAC -3'

Sequencing Primer
(F):5'- CAGGCTGCTGAGGAAAAAGTACATG -3'
(R):5'- CAAATATGAAGAGCTGCTGG -3'
Posted On2020-07-28