Incidental Mutation 'R8287:Hyou1'
ID638494
Institutional Source Beutler Lab
Gene Symbol Hyou1
Ensembl Gene ENSMUSG00000032115
Gene Namehypoxia up-regulated 1
SynonymsGrp170, Cab140, Orp150, 140 kDa, CBP-140
MMRRC Submission
Accession Numbers

Genbank: NM_021395; MGI: 108030

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8287 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location44379490-44392369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44388133 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 707 (D707G)
Ref Sequence ENSEMBL: ENSMUSP00000068594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066601] [ENSMUST00000159473] [ENSMUST00000160902] [ENSMUST00000161318] [ENSMUST00000162560]
Predicted Effect probably benign
Transcript: ENSMUST00000066601
AA Change: D707G

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000068594
Gene: ENSMUSG00000032115
AA Change: D707G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 669 1.3e-101 PFAM
Pfam:HSP70 690 814 2.1e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159473
SMART Domains Protein: ENSMUSP00000124177
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:HSP70 38 226 2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160902
AA Change: D707G

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125594
Gene: ENSMUSG00000032115
AA Change: D707G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161318
AA Change: D707G

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123700
Gene: ENSMUSG00000032115
AA Change: D707G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 671 3.8e-101 PFAM
Pfam:HSP70 690 814 1.2e-6 PFAM
low complexity region 970 986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162560
SMART Domains Protein: ENSMUSP00000123749
Gene: ENSMUSG00000032115

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:HSP70 35 168 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the heat shock protein 70 family. This gene uses alternative transcription start sites. A cis-acting segment found in the 5' UTR is involved in stress-dependent induction, resulting in the accumulation of this protein in the endoplasmic reticulum (ER) under hypoxic conditions. The protein encoded by this gene is thought to play an important role in protein folding and secretion in the ER. Since suppression of the protein is associated with accelerated apoptosis, it is also suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness. This gene also has an alternative translation initiation site, resulting in a protein that lacks the N-terminal signal peptide. This signal peptide-lacking protein, which is only 3 amino acids shorter than the mature protein in the ER, is thought to have a housekeeping function in the cytosol. In rat, this protein localizes to both the ER by a carboxy-terminal peptide sequence and to mitochondria by an amino-terminal targeting signal. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous mice display increased susceptibility to induced neuronal cell death. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,174,078 probably null Het
Apcs T G 1: 172,894,247 L177F possibly damaging Het
Arsa G T 15: 89,473,390 H457N probably benign Het
Blnk T C 19: 40,929,291 Y419C probably damaging Het
Cdon A G 9: 35,463,929 D417G probably benign Het
Cntnap4 T C 8: 112,859,143 S1133P probably damaging Het
Cops2 T A 2: 125,859,117 probably benign Het
Cyp2c40 T A 19: 39,767,455 M472L probably damaging Het
Dlg5 T A 14: 24,164,385 Q379L probably benign Het
Dnah12 A G 14: 26,812,603 I2019V probably benign Het
Dock7 T C 4: 98,977,920 Y1241C unknown Het
Dock8 T C 19: 25,130,461 Y852H probably damaging Het
Fcrlb T A 1: 170,912,084 Y83F probably damaging Het
Foxj2 G A 6: 122,828,267 A33T possibly damaging Het
Gcnt2 T C 13: 40,860,632 F93S probably damaging Het
Gm14180 A G 11: 99,734,242 S17P unknown Het
Gucy1b2 T C 14: 62,411,816 Q437R probably damaging Het
Ncam2 A G 16: 81,526,995 Q509R probably benign Het
Npsr1 T C 9: 24,289,962 V214A probably damaging Het
Olfr919 T C 9: 38,698,337 T14A probably benign Het
Speg T A 1: 75,422,236 M2109K probably benign Het
Stxbp5 T C 10: 9,784,385 H722R probably benign Het
Vmn2r19 A G 6: 123,331,629 N555S probably damaging Het
Xrcc1 G A 7: 24,572,278 R562H probably damaging Het
Zscan18 T G 7: 12,775,371 K67N unknown Het
Other mutations in Hyou1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Hyou1 APN 9 44385146 missense probably benign 0.02
IGL01660:Hyou1 APN 9 44381117 missense possibly damaging 0.75
IGL01677:Hyou1 APN 9 44382012 missense probably benign 0.21
IGL01903:Hyou1 APN 9 44381141 splice site probably benign
IGL02636:Hyou1 APN 9 44381410 critical splice donor site probably null
IGL02806:Hyou1 APN 9 44388883 nonsense probably null
IGL03401:Hyou1 APN 9 44384909 missense probably damaging 1.00
IGL03410:Hyou1 APN 9 44388058 missense probably benign
ANU74:Hyou1 UTSW 9 44381263 missense possibly damaging 0.79
D3080:Hyou1 UTSW 9 44384477 missense probably damaging 0.97
PIT4378001:Hyou1 UTSW 9 44390851 missense probably benign 0.26
R0408:Hyou1 UTSW 9 44384692 missense probably damaging 1.00
R0422:Hyou1 UTSW 9 44389242 missense probably damaging 1.00
R1116:Hyou1 UTSW 9 44384681 missense probably damaging 1.00
R1581:Hyou1 UTSW 9 44388870 missense probably damaging 1.00
R1640:Hyou1 UTSW 9 44389406 missense probably benign 0.02
R1803:Hyou1 UTSW 9 44384182 nonsense probably null
R2060:Hyou1 UTSW 9 44381552 missense probably benign 0.28
R2180:Hyou1 UTSW 9 44388019 missense probably benign 0.30
R2233:Hyou1 UTSW 9 44389091 missense probably benign 0.44
R2235:Hyou1 UTSW 9 44389091 missense probably benign 0.44
R3950:Hyou1 UTSW 9 44385227 missense probably damaging 1.00
R4198:Hyou1 UTSW 9 44388859 missense probably damaging 1.00
R4200:Hyou1 UTSW 9 44388859 missense probably damaging 1.00
R4363:Hyou1 UTSW 9 44380615 splice site probably null
R4393:Hyou1 UTSW 9 44381872 missense probably damaging 1.00
R4394:Hyou1 UTSW 9 44381872 missense probably damaging 1.00
R4812:Hyou1 UTSW 9 44387121 intron probably benign
R5239:Hyou1 UTSW 9 44385263 missense possibly damaging 0.96
R5648:Hyou1 UTSW 9 44385249 missense probably damaging 0.99
R5818:Hyou1 UTSW 9 44388926 critical splice donor site probably null
R5856:Hyou1 UTSW 9 44381344 missense probably damaging 1.00
R6431:Hyou1 UTSW 9 44382025 critical splice donor site probably null
R6594:Hyou1 UTSW 9 44389322 missense probably benign
R6596:Hyou1 UTSW 9 44387755 missense probably benign 0.00
R6613:Hyou1 UTSW 9 44382498 missense probably damaging 0.99
R6704:Hyou1 UTSW 9 44381134 critical splice donor site probably null
R6849:Hyou1 UTSW 9 44387264 missense probably damaging 0.99
R7494:Hyou1 UTSW 9 44389409 missense probably benign 0.04
R7632:Hyou1 UTSW 9 44381136 splice site probably null
R7711:Hyou1 UTSW 9 44384462 missense possibly damaging 0.91
R8064:Hyou1 UTSW 9 44385585 missense possibly damaging 0.80
X0027:Hyou1 UTSW 9 44390856 missense possibly damaging 0.89
Z1176:Hyou1 UTSW 9 44387742 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGAGGAGACAGCTAATGGTTTTC -3'
(R):5'- AGATGAAAGCCTCCAAGCTG -3'

Sequencing Primer
(F):5'- AATGGTTTTCCTTATTACATCACTGC -3'
(R):5'- CTGCTTCTCTAGGTCGCG -3'
Posted On2020-07-28