Incidental Mutation 'R8287:Gm14180'
ID638496
Institutional Source Beutler Lab
Gene Symbol Gm14180
Ensembl Gene ENSMUSG00000078269
Gene Namepredicted gene 14180
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock #R8287 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location99734213-99734290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99734242 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 17 (S17P)
Ref Sequence ENSEMBL: ENSMUSP00000100687 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000105066
AA Change: S17P
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,174,078 probably null Het
Apcs T G 1: 172,894,247 L177F possibly damaging Het
Arsa G T 15: 89,473,390 H457N probably benign Het
Blnk T C 19: 40,929,291 Y419C probably damaging Het
Cdon A G 9: 35,463,929 D417G probably benign Het
Cntnap4 T C 8: 112,859,143 S1133P probably damaging Het
Cops2 T A 2: 125,859,117 probably benign Het
Cyp2c40 T A 19: 39,767,455 M472L probably damaging Het
Dlg5 T A 14: 24,164,385 Q379L probably benign Het
Dnah12 A G 14: 26,812,603 I2019V probably benign Het
Dock7 T C 4: 98,977,920 Y1241C unknown Het
Dock8 T C 19: 25,130,461 Y852H probably damaging Het
Fcrlb T A 1: 170,912,084 Y83F probably damaging Het
Foxj2 G A 6: 122,828,267 A33T possibly damaging Het
Gcnt2 T C 13: 40,860,632 F93S probably damaging Het
Gucy1b2 T C 14: 62,411,816 Q437R probably damaging Het
Hyou1 A G 9: 44,388,133 D707G probably benign Het
Ncam2 A G 16: 81,526,995 Q509R probably benign Het
Npsr1 T C 9: 24,289,962 V214A probably damaging Het
Olfr919 T C 9: 38,698,337 T14A probably benign Het
Speg T A 1: 75,422,236 M2109K probably benign Het
Stxbp5 T C 10: 9,784,385 H722R probably benign Het
Vmn2r19 A G 6: 123,331,629 N555S probably damaging Het
Xrcc1 G A 7: 24,572,278 R562H probably damaging Het
Zscan18 T G 7: 12,775,371 K67N unknown Het
Other mutations in Gm14180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Gm14180 APN 11 99734227 missense unknown
R0133:Gm14180 UTSW 11 99734217 missense unknown
R4491:Gm14180 UTSW 11 99730313 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCCTGGGTTACAATGACCTAC -3'
(R):5'- CCTGAGAGGAGAATCTAGCCTC -3'

Sequencing Primer
(F):5'- CCTGGGTTACAATGACCTACATGAG -3'
(R):5'- AGGAGAATCTAGCCTCGTTTG -3'
Posted On2020-07-28