Incidental Mutation 'R8287:Gcnt2'
ID638498
Institutional Source Beutler Lab
Gene Symbol Gcnt2
Ensembl Gene ENSMUSG00000021360
Gene Nameglucosaminyl (N-acetyl) transferase 2, I-branching enzyme
SynonymsIGnTB, IGnT, IGnTA, IGnTC, 5330430K10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R8287 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location40859754-40960892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40860632 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 93 (F93S)
Ref Sequence ENSEMBL: ENSMUSP00000105820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110191]
Predicted Effect probably damaging
Transcript: ENSMUST00000110191
AA Change: F93S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105820
Gene: ENSMUSG00000021360
AA Change: F93S

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Branch 95 357 5.2e-61 PFAM
low complexity region 377 386 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show hypoactivity, a reduced B cell number, epidermoid cyst formation in male abdominal skin, and impaired renal function with increased blood urea nitrogen and creatinine levels and vacuolization of renal tubular epithelial cells in aging mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,174,078 probably null Het
Apcs T G 1: 172,894,247 L177F possibly damaging Het
Arsa G T 15: 89,473,390 H457N probably benign Het
Blnk T C 19: 40,929,291 Y419C probably damaging Het
Cdon A G 9: 35,463,929 D417G probably benign Het
Cntnap4 T C 8: 112,859,143 S1133P probably damaging Het
Cops2 T A 2: 125,859,117 probably benign Het
Cyp2c40 T A 19: 39,767,455 M472L probably damaging Het
Dlg5 T A 14: 24,164,385 Q379L probably benign Het
Dnah12 A G 14: 26,812,603 I2019V probably benign Het
Dock7 T C 4: 98,977,920 Y1241C unknown Het
Dock8 T C 19: 25,130,461 Y852H probably damaging Het
Fcrlb T A 1: 170,912,084 Y83F probably damaging Het
Foxj2 G A 6: 122,828,267 A33T possibly damaging Het
Gm14180 A G 11: 99,734,242 S17P unknown Het
Gucy1b2 T C 14: 62,411,816 Q437R probably damaging Het
Hyou1 A G 9: 44,388,133 D707G probably benign Het
Ncam2 A G 16: 81,526,995 Q509R probably benign Het
Npsr1 T C 9: 24,289,962 V214A probably damaging Het
Olfr919 T C 9: 38,698,337 T14A probably benign Het
Speg T A 1: 75,422,236 M2109K probably benign Het
Stxbp5 T C 10: 9,784,385 H722R probably benign Het
Vmn2r19 A G 6: 123,331,629 N555S probably damaging Het
Xrcc1 G A 7: 24,572,278 R562H probably damaging Het
Zscan18 T G 7: 12,775,371 K67N unknown Het
Other mutations in Gcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Gcnt2 APN 13 40887863 missense probably benign 0.06
IGL01693:Gcnt2 APN 13 40888073 missense probably benign
IGL02506:Gcnt2 APN 13 40887380 missense probably benign 0.02
IGL03184:Gcnt2 APN 13 40888184 missense probably benign 0.01
BB001:Gcnt2 UTSW 13 40918564 nonsense probably null
BB011:Gcnt2 UTSW 13 40918564 nonsense probably null
PIT4472001:Gcnt2 UTSW 13 40917937 missense probably benign 0.39
R0358:Gcnt2 UTSW 13 40860853 missense probably damaging 0.99
R0734:Gcnt2 UTSW 13 40860521 missense probably benign 0.00
R1863:Gcnt2 UTSW 13 40861101 missense possibly damaging 0.95
R3103:Gcnt2 UTSW 13 40918606 missense probably benign 0.00
R3156:Gcnt2 UTSW 13 40861178 missense probably benign 0.36
R3893:Gcnt2 UTSW 13 40860446 missense probably benign 0.14
R4134:Gcnt2 UTSW 13 40887807 missense probably damaging 1.00
R4135:Gcnt2 UTSW 13 40887807 missense probably damaging 1.00
R4279:Gcnt2 UTSW 13 40888190 missense probably benign 0.17
R4422:Gcnt2 UTSW 13 40860525 nonsense probably null
R4599:Gcnt2 UTSW 13 40887490 missense probably benign
R4618:Gcnt2 UTSW 13 40958194 nonsense probably null
R4908:Gcnt2 UTSW 13 40860734 missense probably damaging 1.00
R5123:Gcnt2 UTSW 13 40918355 missense probably damaging 0.99
R5291:Gcnt2 UTSW 13 40918792 missense probably damaging 1.00
R5437:Gcnt2 UTSW 13 40861176 missense probably damaging 1.00
R5463:Gcnt2 UTSW 13 40918174 missense possibly damaging 0.80
R5471:Gcnt2 UTSW 13 40860719 missense probably damaging 1.00
R5472:Gcnt2 UTSW 13 40953579 missense probably benign 0.30
R5493:Gcnt2 UTSW 13 40953600 missense possibly damaging 0.70
R5586:Gcnt2 UTSW 13 40860953 missense probably damaging 1.00
R5695:Gcnt2 UTSW 13 40918199 missense probably benign 0.03
R6244:Gcnt2 UTSW 13 40861241 missense probably damaging 1.00
R6293:Gcnt2 UTSW 13 40918697 missense probably damaging 1.00
R7036:Gcnt2 UTSW 13 40887556 frame shift probably null
R7077:Gcnt2 UTSW 13 40860420 missense probably benign
R7432:Gcnt2 UTSW 13 40887212 intron probably benign
R7474:Gcnt2 UTSW 13 40958257 missense probably damaging 1.00
R7508:Gcnt2 UTSW 13 40887681 missense probably benign 0.02
R7599:Gcnt2 UTSW 13 40860867 nonsense probably null
R7678:Gcnt2 UTSW 13 40953719 missense probably benign 0.01
R7806:Gcnt2 UTSW 13 40918241 missense probably damaging 1.00
R7808:Gcnt2 UTSW 13 40860862 missense possibly damaging 0.81
R7909:Gcnt2 UTSW 13 40860450 missense probably benign 0.00
R7924:Gcnt2 UTSW 13 40918564 nonsense probably null
R8110:Gcnt2 UTSW 13 40917722 start gained probably benign
Z1088:Gcnt2 UTSW 13 40918639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCGGTTTCCAATATTTCAGTC -3'
(R):5'- AGTTCAGATCAGCTTGGAGCC -3'

Sequencing Primer
(F):5'- TCAGTCTTAGCGGAAGTCTGC -3'
(R):5'- TCCATCCTAGAGGCCAGGAAG -3'
Posted On2020-07-28