Incidental Mutation 'R8287:Gucy1b2'
ID638501
Institutional Source Beutler Lab
Gene Symbol Gucy1b2
Ensembl Gene ENSMUSG00000021933
Gene Nameguanylate cyclase 1, soluble, beta 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R8287 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location62392676-62456289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62411816 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 437 (Q437R)
Ref Sequence ENSEMBL: ENSMUSP00000022501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022501] [ENSMUST00000165651]
Predicted Effect probably damaging
Transcript: ENSMUST00000022501
AA Change: Q437R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022501
Gene: ENSMUSG00000021933
AA Change: Q437R

DomainStartEndE-ValueType
Pfam:HNOB 83 244 6e-60 PFAM
Blast:CYCc 263 362 3e-24 BLAST
PDB:4GJ4|D 350 471 4e-8 PDB
CYCc 513 712 1.11e-108 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165651
AA Change: Q422R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128114
Gene: ENSMUSG00000021933
AA Change: Q422R

DomainStartEndE-ValueType
Pfam:HNOB 82 250 1.1e-53 PFAM
Blast:CYCc 263 347 6e-25 BLAST
PDB:4GJ4|D 335 456 5e-8 PDB
CYCc 498 697 1.11e-108 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal hyperventilation response to a 10% oxygen environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,174,078 probably null Het
Apcs T G 1: 172,894,247 L177F possibly damaging Het
Arsa G T 15: 89,473,390 H457N probably benign Het
Blnk T C 19: 40,929,291 Y419C probably damaging Het
Cdon A G 9: 35,463,929 D417G probably benign Het
Cntnap4 T C 8: 112,859,143 S1133P probably damaging Het
Cops2 T A 2: 125,859,117 probably benign Het
Cyp2c40 T A 19: 39,767,455 M472L probably damaging Het
Dlg5 T A 14: 24,164,385 Q379L probably benign Het
Dnah12 A G 14: 26,812,603 I2019V probably benign Het
Dock7 T C 4: 98,977,920 Y1241C unknown Het
Dock8 T C 19: 25,130,461 Y852H probably damaging Het
Fcrlb T A 1: 170,912,084 Y83F probably damaging Het
Foxj2 G A 6: 122,828,267 A33T possibly damaging Het
Gcnt2 T C 13: 40,860,632 F93S probably damaging Het
Gm14180 A G 11: 99,734,242 S17P unknown Het
Hyou1 A G 9: 44,388,133 D707G probably benign Het
Ncam2 A G 16: 81,526,995 Q509R probably benign Het
Npsr1 T C 9: 24,289,962 V214A probably damaging Het
Olfr919 T C 9: 38,698,337 T14A probably benign Het
Speg T A 1: 75,422,236 M2109K probably benign Het
Stxbp5 T C 10: 9,784,385 H722R probably benign Het
Vmn2r19 A G 6: 123,331,629 N555S probably damaging Het
Xrcc1 G A 7: 24,572,278 R562H probably damaging Het
Zscan18 T G 7: 12,775,371 K67N unknown Het
Other mutations in Gucy1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Gucy1b2 APN 14 62406245 missense probably damaging 1.00
IGL00465:Gucy1b2 APN 14 62403200 missense probably benign
IGL00756:Gucy1b2 APN 14 62403209 missense probably benign
IGL01800:Gucy1b2 APN 14 62411655 missense probably benign 0.03
IGL01875:Gucy1b2 APN 14 62420146 missense probably damaging 1.00
IGL03033:Gucy1b2 APN 14 62415944 missense probably benign 0.00
IGL03110:Gucy1b2 APN 14 62433834 splice site probably benign
IGL02796:Gucy1b2 UTSW 14 62407694 missense probably benign 0.42
R0183:Gucy1b2 UTSW 14 62419140 missense probably damaging 1.00
R0605:Gucy1b2 UTSW 14 62403159 splice site probably benign
R0815:Gucy1b2 UTSW 14 62419062 missense probably benign 0.00
R0863:Gucy1b2 UTSW 14 62419062 missense probably benign 0.00
R0972:Gucy1b2 UTSW 14 62408678 missense possibly damaging 0.88
R0972:Gucy1b2 UTSW 14 62414369 missense possibly damaging 0.61
R1438:Gucy1b2 UTSW 14 62414321 missense probably damaging 0.98
R2011:Gucy1b2 UTSW 14 62408758 missense probably damaging 0.99
R2409:Gucy1b2 UTSW 14 62406179 frame shift probably null
R3692:Gucy1b2 UTSW 14 62404627 missense probably damaging 1.00
R4484:Gucy1b2 UTSW 14 62411589 missense possibly damaging 0.88
R4715:Gucy1b2 UTSW 14 62423017 missense possibly damaging 0.95
R4730:Gucy1b2 UTSW 14 62407759 missense probably damaging 1.00
R4812:Gucy1b2 UTSW 14 62415897 splice site probably null
R4839:Gucy1b2 UTSW 14 62448246 missense probably damaging 1.00
R5261:Gucy1b2 UTSW 14 62404579 missense probably damaging 1.00
R5326:Gucy1b2 UTSW 14 62453330 critical splice donor site probably null
R5656:Gucy1b2 UTSW 14 62422981 missense probably damaging 1.00
R5779:Gucy1b2 UTSW 14 62414301 missense possibly damaging 0.82
R6000:Gucy1b2 UTSW 14 62419050 missense probably benign 0.00
R6274:Gucy1b2 UTSW 14 62415939 missense probably damaging 1.00
R7457:Gucy1b2 UTSW 14 62392952 missense probably benign 0.08
R7487:Gucy1b2 UTSW 14 62448223 missense probably damaging 0.97
R7607:Gucy1b2 UTSW 14 62419177 missense probably damaging 1.00
R8030:Gucy1b2 UTSW 14 62392870 missense probably benign
R8285:Gucy1b2 UTSW 14 62420107 missense probably damaging 0.98
RF030:Gucy1b2 UTSW 14 62408641 critical splice donor site probably benign
RF035:Gucy1b2 UTSW 14 62408641 critical splice donor site probably benign
Z1177:Gucy1b2 UTSW 14 62453453 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTCTTCTCCAGTTGGCAGGAC -3'
(R):5'- TGCAGTCACGGGAAGAGTTG -3'

Sequencing Primer
(F):5'- AGTTGGCAGGACAGTTCCATCTC -3'
(R):5'- TCACGGGAAGAGTTGCTGGG -3'
Posted On2020-07-28