Incidental Mutation 'R8287:Arsa'
ID638502
Institutional Source Beutler Lab
Gene Symbol Arsa
Ensembl Gene ENSMUSG00000022620
Gene Namearylsulfatase A
SynonymsAs2, As-2, ASA, AS-A
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R8287 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location89472476-89477425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89473390 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 457 (H457N)
Ref Sequence ENSEMBL: ENSMUSP00000127646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165199]
Predicted Effect probably benign
Transcript: ENSMUST00000165199
AA Change: H457N

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127646
Gene: ENSMUSG00000022620
AA Change: H457N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Sulfatase 20 345 4.2e-79 PFAM
Pfam:Sulfatase_C 367 501 1.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168270
SMART Domains Protein: ENSMUSP00000130574
Gene: ENSMUSG00000022620

DomainStartEndE-ValueType
Pfam:Sulfatase 1 37 1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene hydrolyzes cerebroside sulfate to cerebroside and sulfate. Defects in this gene lead to metachromatic leucodystrophy (MLD), a progressive demyelination disease which results in a variety of neurological symptoms and ultimately death. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mice exhibit impaired balance and spatial learning ability. Sulfatide accumulates in the white matter of the brain and a reduced myelin sheath thickness in the corpus callosum and optic nerves is seen. A low frequency of head tremor develops after 2 years of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,174,078 probably null Het
Apcs T G 1: 172,894,247 L177F possibly damaging Het
Blnk T C 19: 40,929,291 Y419C probably damaging Het
Cdon A G 9: 35,463,929 D417G probably benign Het
Cntnap4 T C 8: 112,859,143 S1133P probably damaging Het
Cops2 T A 2: 125,859,117 probably benign Het
Cyp2c40 T A 19: 39,767,455 M472L probably damaging Het
Dlg5 T A 14: 24,164,385 Q379L probably benign Het
Dnah12 A G 14: 26,812,603 I2019V probably benign Het
Dock7 T C 4: 98,977,920 Y1241C unknown Het
Dock8 T C 19: 25,130,461 Y852H probably damaging Het
Fcrlb T A 1: 170,912,084 Y83F probably damaging Het
Foxj2 G A 6: 122,828,267 A33T possibly damaging Het
Gcnt2 T C 13: 40,860,632 F93S probably damaging Het
Gm14180 A G 11: 99,734,242 S17P unknown Het
Gucy1b2 T C 14: 62,411,816 Q437R probably damaging Het
Hyou1 A G 9: 44,388,133 D707G probably benign Het
Ncam2 A G 16: 81,526,995 Q509R probably benign Het
Npsr1 T C 9: 24,289,962 V214A probably damaging Het
Olfr919 T C 9: 38,698,337 T14A probably benign Het
Speg T A 1: 75,422,236 M2109K probably benign Het
Stxbp5 T C 10: 9,784,385 H722R probably benign Het
Vmn2r19 A G 6: 123,331,629 N555S probably damaging Het
Xrcc1 G A 7: 24,572,278 R562H probably damaging Het
Zscan18 T G 7: 12,775,371 K67N unknown Het
Other mutations in Arsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02079:Arsa APN 15 89473351 missense probably benign 0.04
IGL02381:Arsa APN 15 89475537 nonsense probably null
IGL02416:Arsa APN 15 89474788 missense probably damaging 1.00
IGL02997:Arsa APN 15 89474038 missense probably damaging 0.99
R0066:Arsa UTSW 15 89474336 missense possibly damaging 0.88
R0066:Arsa UTSW 15 89474336 missense possibly damaging 0.88
R0630:Arsa UTSW 15 89474004 splice site probably benign
R1052:Arsa UTSW 15 89475177 missense probably damaging 1.00
R1079:Arsa UTSW 15 89474225 splice site probably benign
R1807:Arsa UTSW 15 89475322 missense possibly damaging 0.54
R1943:Arsa UTSW 15 89473539 missense probably damaging 1.00
R2231:Arsa UTSW 15 89475722 start codon destroyed probably null
R5099:Arsa UTSW 15 89475339 missense probably damaging 1.00
R5461:Arsa UTSW 15 89473275 missense probably benign
R6259:Arsa UTSW 15 89475521 missense probably damaging 1.00
R7159:Arsa UTSW 15 89474718 splice site probably null
R7188:Arsa UTSW 15 89475627 nonsense probably null
R7735:Arsa UTSW 15 89474949 nonsense probably null
R7943:Arsa UTSW 15 89474089 missense probably damaging 1.00
R8127:Arsa UTSW 15 89474864 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACACACTCAGGACAGGG -3'
(R):5'- GCTCATTTCTTCACCCAGGG -3'

Sequencing Primer
(F):5'- TGAAGGACCCCCGTGATTTC -3'
(R):5'- GCCCCTCCTTATGTAAAAAGCTG -3'
Posted On2020-07-28