Incidental Mutation 'R8287:Ncam2'
ID638503
Institutional Source Beutler Lab
Gene Symbol Ncam2
Ensembl Gene ENSMUSG00000022762
Gene Nameneural cell adhesion molecule 2
SynonymsOcam, RNCAM, Ncam-2, R4B12 antigen
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8287 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location81200697-81626828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81526995 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 509 (Q509R)
Ref Sequence ENSEMBL: ENSMUSP00000063468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037785] [ENSMUST00000067602]
Predicted Effect probably benign
Transcript: ENSMUST00000037785
AA Change: Q509R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000049390
Gene: ENSMUSG00000022762
AA Change: Q509R

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067602
AA Change: Q509R

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762
AA Change: Q509R

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
low complexity region 789 812 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (27/27)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein and may function in selective fasciculation and zone-to-zone projection of the primary olfactory axons. [provided by RefSeq, Jul 2008]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a knock-out allele exhibit exhibit increased proliferation rate and clonogenic frequency in spinal cord-derived neurospheres. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,174,078 probably null Het
Apcs T G 1: 172,894,247 L177F possibly damaging Het
Arsa G T 15: 89,473,390 H457N probably benign Het
Atg10 A T 13: 91,022,680 probably benign Het
Blnk T C 19: 40,929,291 Y419C probably damaging Het
Cdon A G 9: 35,463,929 D417G probably benign Het
Cntnap4 T C 8: 112,859,143 S1133P probably damaging Het
Cops2 T A 2: 125,859,117 probably benign Het
Cyp2c40 T A 19: 39,767,455 M472L probably damaging Het
Dlg5 T A 14: 24,164,385 Q379L probably benign Het
Dnah12 A G 14: 26,812,603 I2019V probably benign Het
Dock7 T C 4: 98,977,920 Y1241C unknown Het
Dock8 T C 19: 25,130,461 Y852H probably damaging Het
Fcrlb T A 1: 170,912,084 Y83F probably damaging Het
Foxj2 G A 6: 122,828,267 A33T possibly damaging Het
Gcnt2 T C 13: 40,860,632 F93S probably damaging Het
Gm14180 A G 11: 99,734,242 S17P unknown Het
Gucy1b2 T C 14: 62,411,816 Q437R probably damaging Het
Hyou1 A G 9: 44,388,133 D707G probably benign Het
Npsr1 T C 9: 24,289,962 V214A probably damaging Het
Olfr919 T C 9: 38,698,337 T14A probably benign Het
Slc50a1 G A 3: 89,270,403 probably benign Het
Speg T A 1: 75,422,236 M2109K probably benign Het
Stxbp5 T C 10: 9,784,385 H722R probably benign Het
Vmn2r19 A G 6: 123,331,629 N555S probably damaging Het
Xrcc1 G A 7: 24,572,278 R562H probably damaging Het
Zscan18 T G 7: 12,775,371 K67N unknown Het
Other mutations in Ncam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Ncam2 APN 16 81517579 missense probably damaging 1.00
IGL01369:Ncam2 APN 16 81461571 missense probably benign 0.09
IGL01554:Ncam2 APN 16 81512935 missense possibly damaging 0.88
IGL01892:Ncam2 APN 16 81589699 missense possibly damaging 0.71
IGL02320:Ncam2 APN 16 81434837 missense probably damaging 0.99
IGL02669:Ncam2 APN 16 81517541 missense probably benign 0.18
IGL03073:Ncam2 APN 16 81621347 missense possibly damaging 0.70
IGL03353:Ncam2 APN 16 81434900 missense probably benign 0.04
BB009:Ncam2 UTSW 16 81615820 missense probably damaging 0.99
BB019:Ncam2 UTSW 16 81615820 missense probably damaging 0.99
R0087:Ncam2 UTSW 16 81434901 missense probably benign 0.11
R0097:Ncam2 UTSW 16 81517537 missense probably damaging 1.00
R0276:Ncam2 UTSW 16 81517629 splice site probably benign
R0279:Ncam2 UTSW 16 81623337 splice site probably benign
R0471:Ncam2 UTSW 16 81200884 start gained probably benign
R0523:Ncam2 UTSW 16 81461643 missense probably damaging 0.99
R1353:Ncam2 UTSW 16 81200915 start codon destroyed probably null
R1646:Ncam2 UTSW 16 81465706 critical splice donor site probably benign
R1884:Ncam2 UTSW 16 81437683 missense probably damaging 1.00
R2002:Ncam2 UTSW 16 81589698 missense possibly damaging 0.70
R2157:Ncam2 UTSW 16 81490389 missense probably damaging 1.00
R2330:Ncam2 UTSW 16 81512921 missense probably benign 0.17
R2404:Ncam2 UTSW 16 81490240 splice site probably benign
R2434:Ncam2 UTSW 16 81595225 missense probably benign 0.01
R3104:Ncam2 UTSW 16 81465710 splice site probably benign
R3842:Ncam2 UTSW 16 81434810 missense probably damaging 1.00
R3954:Ncam2 UTSW 16 81589724 missense probably damaging 1.00
R4039:Ncam2 UTSW 16 81490323 missense probably benign 0.02
R4210:Ncam2 UTSW 16 81527103 missense probably benign 0.02
R4514:Ncam2 UTSW 16 81512996 missense probably benign 0.13
R4583:Ncam2 UTSW 16 81517557 missense probably damaging 1.00
R4586:Ncam2 UTSW 16 81465569 missense probably benign 0.06
R4710:Ncam2 UTSW 16 81465706 critical splice donor site probably null
R4732:Ncam2 UTSW 16 81434884 missense possibly damaging 0.63
R4733:Ncam2 UTSW 16 81434884 missense possibly damaging 0.63
R4876:Ncam2 UTSW 16 81490346 missense probably benign 0.27
R4923:Ncam2 UTSW 16 81589791 missense possibly damaging 0.48
R5131:Ncam2 UTSW 16 81437662 missense probably benign 0.44
R5329:Ncam2 UTSW 16 81434819 missense probably damaging 1.00
R5478:Ncam2 UTSW 16 81434878 nonsense probably null
R5479:Ncam2 UTSW 16 81434878 nonsense probably null
R5481:Ncam2 UTSW 16 81434878 nonsense probably null
R5519:Ncam2 UTSW 16 81434878 nonsense probably null
R5522:Ncam2 UTSW 16 81434878 nonsense probably null
R5523:Ncam2 UTSW 16 81434878 nonsense probably null
R5524:Ncam2 UTSW 16 81434878 nonsense probably null
R5526:Ncam2 UTSW 16 81434878 nonsense probably null
R5718:Ncam2 UTSW 16 81589814 splice site probably null
R5793:Ncam2 UTSW 16 81576103 missense possibly damaging 0.95
R6050:Ncam2 UTSW 16 81443166 nonsense probably null
R6212:Ncam2 UTSW 16 81432762 missense probably damaging 1.00
R6847:Ncam2 UTSW 16 81432718 missense probably damaging 1.00
R6935:Ncam2 UTSW 16 81526991 missense probably benign 0.24
R7159:Ncam2 UTSW 16 81490374 missense probably damaging 1.00
R7193:Ncam2 UTSW 16 81589795 missense probably damaging 1.00
R7232:Ncam2 UTSW 16 81512871 missense probably damaging 1.00
R7346:Ncam2 UTSW 16 81623368 missense probably damaging 1.00
R7568:Ncam2 UTSW 16 81589801 missense probably benign 0.19
R7686:Ncam2 UTSW 16 81621454 missense probably damaging 0.99
R7759:Ncam2 UTSW 16 81615784 missense probably damaging 1.00
R7848:Ncam2 UTSW 16 81490379 missense probably benign
R7932:Ncam2 UTSW 16 81615820 missense probably damaging 0.99
R8078:Ncam2 UTSW 16 81443248 missense possibly damaging 0.60
R8429:Ncam2 UTSW 16 81589635 missense probably damaging 1.00
R8507:Ncam2 UTSW 16 81512979 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TGCAAGGTTTGTAACTAAGATGCG -3'
(R):5'- TTCTCAATCACCCGGCAAG -3'

Sequencing Primer
(F):5'- AGGTTTGTAACTAAGATGCGTTAAGG -3'
(R):5'- GATGAATAGGCACACCTC -3'
Posted On2020-07-28