Incidental Mutation 'R8288:Cnnm3'
ID638507
Institutional Source Beutler Lab
Gene Symbol Cnnm3
Ensembl Gene ENSMUSG00000001138
Gene Namecyclin M3
SynonymsAcdp3
MMRRC Submission
Accession Numbers

Genbank: NM_053186, NM_001039551; MGI: 2151055

Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R8288 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location36511867-36528237 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36511993 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 28 (A28E)
Ref Sequence ENSEMBL: ENSMUSP00000001166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001166] [ENSMUST00000097776] [ENSMUST00000153128]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001166
AA Change: A28E

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001166
Gene: ENSMUSG00000001138
AA Change: A28E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 25 35 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Pfam:DUF21 142 295 3.2e-10 PFAM
Blast:CBS 329 379 9e-12 BLAST
Pfam:CBS 388 452 6.4e-6 PFAM
Blast:cNMP 527 668 2e-38 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000097776
AA Change: A28E

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095383
Gene: ENSMUSG00000001138
AA Change: A28E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 25 35 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Pfam:DUF21 142 300 1e-19 PFAM
Blast:CBS 329 379 9e-12 BLAST
Pfam:CBS 388 452 5.1e-6 PFAM
Blast:cNMP 527 668 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153128
SMART Domains Protein: ENSMUSP00000121317
Gene: ENSMUSG00000037408

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:DUF21 181 355 1.1e-35 PFAM
SCOP:d1jr1a3 373 424 1e-3 SMART
Blast:CBS 379 429 9e-13 BLAST
Pfam:CBS 438 502 6.9e-4 PFAM
Blast:cNMP 572 705 2e-72 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 C T 8: 22,793,137 A200T probably benign Het
Arpp19 T C 9: 75,037,632 M1T probably null Het
Baiap2 T A 11: 119,997,639 V407E probably damaging Het
Cdh18 A G 15: 23,445,987 T508A probably damaging Het
Cpb1 A T 3: 20,265,367 C184* probably null Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Disp2 T C 2: 118,790,281 V498A probably damaging Het
Dmgdh T C 13: 93,708,824 Y442H probably damaging Het
Eef2k T A 7: 120,903,381 M722K probably damaging Het
Erbb4 A G 1: 68,298,350 F603S probably damaging Het
Filip1l C T 16: 57,570,554 R502C probably damaging Het
Gbp9 C T 5: 105,105,733 V39M probably damaging Het
Gm17079 T C 14: 51,694,358 Y98C Het
Gstz1 A G 12: 87,147,830 M1V probably null Het
Hsd17b13 T G 5: 103,963,835 I281L probably benign Het
Hydin A G 8: 110,507,029 E1833G probably damaging Het
Irs1 G A 1: 82,287,961 Q845* probably null Het
Kctd11 C T 11: 69,880,057 G52R probably damaging Het
Kit T C 5: 75,654,489 S962P probably damaging Het
Lrrn1 C T 6: 107,566,994 probably benign Het
Mastl T C 2: 23,133,359 K451E probably damaging Het
Mptx2 A G 1: 173,274,789 V111A probably benign Het
Nuak2 G T 1: 132,327,841 C178F probably damaging Het
Pah G A 10: 87,538,185 R71H probably benign Het
Pclo C A 5: 14,712,871 T501K Het
Pla2g4e C T 2: 120,188,509 probably null Het
Polq A G 16: 37,027,910 E293G probably damaging Het
Rptor G A 11: 119,857,937 E782K probably benign Het
Scn7a T A 2: 66,675,974 R1524W probably damaging Het
Slc4a5 T C 6: 83,226,255 S46P probably benign Het
Srcap T A 7: 127,531,356 I664N probably damaging Het
Stk24 A C 14: 121,293,429 F372V possibly damaging Het
Szt2 T C 4: 118,389,776 S881G probably damaging Het
Trim40 T C 17: 36,883,318 D161G probably benign Het
Trip11 T C 12: 101,894,384 H234R possibly damaging Het
Trpc1 T C 9: 95,721,381 K366R probably damaging Het
Ugt2b35 T C 5: 87,001,457 L189P probably damaging Het
Unc80 A G 1: 66,473,350 S140G probably benign Het
Wdr60 A G 12: 116,213,725 F811S probably damaging Het
Zfp446 A G 7: 12,977,958 E36G probably benign Het
Zfp738 T A 13: 67,670,789 H361L possibly damaging Het
Other mutations in Cnnm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Cnnm3 APN 1 36512875 missense probably benign 0.12
IGL02679:Cnnm3 APN 1 36520158 missense probably benign 0.01
IGL02700:Cnnm3 APN 1 36513108 missense probably damaging 1.00
IGL03165:Cnnm3 APN 1 36525232 unclassified probably benign
R0003:Cnnm3 UTSW 1 36524043 missense probably benign 0.02
R0358:Cnnm3 UTSW 1 36521222 missense probably damaging 0.98
R1129:Cnnm3 UTSW 1 36513016 missense probably damaging 1.00
R1772:Cnnm3 UTSW 1 36518957 missense probably damaging 1.00
R2929:Cnnm3 UTSW 1 36524059 missense possibly damaging 0.55
R3153:Cnnm3 UTSW 1 36521222 missense probably damaging 0.98
R3154:Cnnm3 UTSW 1 36521222 missense probably damaging 0.98
R5376:Cnnm3 UTSW 1 36520678 missense probably damaging 1.00
R5810:Cnnm3 UTSW 1 36525199 missense probably benign 0.02
R6389:Cnnm3 UTSW 1 36520522 missense probably damaging 0.99
R8959:Cnnm3 UTSW 1 36519015 missense probably damaging 1.00
X0064:Cnnm3 UTSW 1 36512980 missense probably damaging 1.00
Z1177:Cnnm3 UTSW 1 36513033 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCCGCTTATTGGTCAAAGTG -3'
(R):5'- TACAGCAGCACGGCCAGT -3'

Sequencing Primer
(F):5'- TCAAAGTGACGCGGAGGCC -3'
(R):5'- CAGCACCTGCACCTCGG -3'
Posted On2020-07-28