Incidental Mutation 'R8288:Unc80'
ID 638508
Institutional Source Beutler Lab
Gene Symbol Unc80
Ensembl Gene ENSMUSG00000055567
Gene Name unc-80, NALCN activator
Synonyms C230061B10Rik, C030018G13Rik
MMRRC Submission 067710-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.912) question?
Stock # R8288 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 66507526-66738307 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66512509 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 140 (S140G)
Ref Sequence ENSEMBL: ENSMUSP00000053692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000114008] [ENSMUST00000212557]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000061620
AA Change: S140G

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: S140G

DomainStartEndE-ValueType
Pfam:UNC80 16 236 2.2e-94 PFAM
low complexity region 372 385 N/A INTRINSIC
low complexity region 493 502 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 739 769 N/A INTRINSIC
low complexity region 1038 1055 N/A INTRINSIC
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1309 1328 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1676 1681 N/A INTRINSIC
low complexity region 1842 1848 N/A INTRINSIC
low complexity region 1854 1868 N/A INTRINSIC
low complexity region 2461 2480 N/A INTRINSIC
low complexity region 2726 2740 N/A INTRINSIC
low complexity region 3121 3144 N/A INTRINSIC
low complexity region 3245 3254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114008
AA Change: S140G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000212557
AA Change: S140G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 C T 8: 23,283,153 (GRCm39) A200T probably benign Het
Arpp19 T C 9: 74,944,914 (GRCm39) M1T probably null Het
Baiap2 T A 11: 119,888,465 (GRCm39) V407E probably damaging Het
Cdh18 A G 15: 23,446,073 (GRCm39) T508A probably damaging Het
Cnnm3 C A 1: 36,551,074 (GRCm39) A28E possibly damaging Het
Cpb1 A T 3: 20,319,531 (GRCm39) C184* probably null Het
Ddb1 T C 19: 10,585,712 (GRCm39) V142A probably benign Het
Disp2 T C 2: 118,620,762 (GRCm39) V498A probably damaging Het
Dmgdh T C 13: 93,845,332 (GRCm39) Y442H probably damaging Het
Dync2i1 A G 12: 116,177,345 (GRCm39) F811S probably damaging Het
Eef2k T A 7: 120,502,604 (GRCm39) M722K probably damaging Het
Erbb4 A G 1: 68,337,509 (GRCm39) F603S probably damaging Het
Filip1l C T 16: 57,390,917 (GRCm39) R502C probably damaging Het
Gbp9 C T 5: 105,253,599 (GRCm39) V39M probably damaging Het
Gm17079 T C 14: 51,931,815 (GRCm39) Y98C Het
Gstz1 A G 12: 87,194,604 (GRCm39) M1V probably null Het
Hsd17b13 T G 5: 104,111,701 (GRCm39) I281L probably benign Het
Hydin A G 8: 111,233,661 (GRCm39) E1833G probably damaging Het
Irs1 G A 1: 82,265,682 (GRCm39) Q845* probably null Het
Kctd11 C T 11: 69,770,883 (GRCm39) G52R probably damaging Het
Kit T C 5: 75,815,149 (GRCm39) S962P probably damaging Het
Lrrn1 C T 6: 107,543,955 (GRCm39) probably benign Het
Mastl T C 2: 23,023,371 (GRCm39) K451E probably damaging Het
Mptx2 A G 1: 173,102,356 (GRCm39) V111A probably benign Het
Nuak2 G T 1: 132,255,579 (GRCm39) C178F probably damaging Het
Pah G A 10: 87,374,047 (GRCm39) R71H probably benign Het
Pclo C A 5: 14,762,885 (GRCm39) T501K Het
Pla2g4e C T 2: 120,018,990 (GRCm39) probably null Het
Polq A G 16: 36,848,272 (GRCm39) E293G probably damaging Het
Rptor G A 11: 119,748,763 (GRCm39) E782K probably benign Het
Scn7a T A 2: 66,506,318 (GRCm39) R1524W probably damaging Het
Slc4a5 T C 6: 83,203,237 (GRCm39) S46P probably benign Het
Srcap T A 7: 127,130,528 (GRCm39) I664N probably damaging Het
Stk24 A C 14: 121,530,841 (GRCm39) F372V possibly damaging Het
Szt2 T C 4: 118,246,973 (GRCm39) S881G probably damaging Het
Trim40 T C 17: 37,194,210 (GRCm39) D161G probably benign Het
Trip11 T C 12: 101,860,643 (GRCm39) H234R possibly damaging Het
Trpc1 T C 9: 95,603,434 (GRCm39) K366R probably damaging Het
Ugt2b35 T C 5: 87,149,316 (GRCm39) L189P probably damaging Het
Zfp446 A G 7: 12,711,885 (GRCm39) E36G probably benign Het
Zfp738 T A 13: 67,818,908 (GRCm39) H361L possibly damaging Het
Other mutations in Unc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Unc80 APN 1 66,693,554 (GRCm39) missense possibly damaging 0.53
IGL00340:Unc80 APN 1 66,645,618 (GRCm39) missense possibly damaging 0.73
IGL00783:Unc80 APN 1 66,647,596 (GRCm39) missense probably benign 0.37
IGL00784:Unc80 APN 1 66,647,596 (GRCm39) missense probably benign 0.37
IGL00935:Unc80 APN 1 66,666,425 (GRCm39) missense possibly damaging 0.53
IGL01094:Unc80 APN 1 66,734,592 (GRCm39) missense possibly damaging 0.90
IGL01466:Unc80 APN 1 66,661,645 (GRCm39) missense probably benign 0.33
IGL01577:Unc80 APN 1 66,569,127 (GRCm39) splice site probably null
IGL01626:Unc80 APN 1 66,590,213 (GRCm39) critical splice donor site probably null
IGL01640:Unc80 APN 1 66,718,744 (GRCm39) missense probably benign 0.33
IGL01775:Unc80 APN 1 66,640,215 (GRCm39) missense possibly damaging 0.94
IGL01960:Unc80 APN 1 66,647,659 (GRCm39) splice site probably benign
IGL01991:Unc80 APN 1 66,508,668 (GRCm39) nonsense probably null
IGL02022:Unc80 APN 1 66,665,675 (GRCm39) missense possibly damaging 0.53
IGL02073:Unc80 APN 1 66,651,386 (GRCm39) missense possibly damaging 0.85
IGL02077:Unc80 APN 1 66,564,875 (GRCm39) missense possibly damaging 0.77
IGL02197:Unc80 APN 1 66,569,224 (GRCm39) missense probably benign 0.39
IGL02198:Unc80 APN 1 66,569,145 (GRCm39) missense possibly damaging 0.88
IGL02228:Unc80 APN 1 66,647,587 (GRCm39) missense possibly damaging 0.72
IGL02327:Unc80 APN 1 66,680,832 (GRCm39) missense probably benign 0.33
IGL02447:Unc80 APN 1 66,542,703 (GRCm39) missense possibly damaging 0.86
IGL02489:Unc80 APN 1 66,564,860 (GRCm39) missense probably benign 0.07
IGL02546:Unc80 APN 1 66,594,112 (GRCm39) missense possibly damaging 0.83
IGL02629:Unc80 APN 1 66,522,476 (GRCm39) missense possibly damaging 0.46
IGL02631:Unc80 APN 1 66,569,222 (GRCm39) missense probably damaging 0.98
IGL02839:Unc80 APN 1 66,710,834 (GRCm39) missense possibly damaging 0.53
IGL02960:Unc80 APN 1 66,717,217 (GRCm39) splice site probably benign
IGL02974:Unc80 APN 1 66,564,817 (GRCm39) missense possibly damaging 0.95
IGL03060:Unc80 APN 1 66,676,169 (GRCm39) missense possibly damaging 0.96
IGL03062:Unc80 APN 1 66,548,648 (GRCm39) missense probably damaging 0.96
IGL03074:Unc80 APN 1 66,710,877 (GRCm39) splice site probably benign
IGL03086:Unc80 APN 1 66,548,633 (GRCm39) missense probably damaging 0.99
IGL03105:Unc80 APN 1 66,511,258 (GRCm39) missense probably damaging 0.96
IGL03107:Unc80 APN 1 66,670,613 (GRCm39) missense probably damaging 0.98
IGL03158:Unc80 APN 1 66,680,833 (GRCm39) missense probably benign 0.33
IGL03220:Unc80 APN 1 66,544,097 (GRCm39) missense probably damaging 0.99
IGL03271:Unc80 APN 1 66,734,762 (GRCm39) unclassified probably benign
IGL03332:Unc80 APN 1 66,542,790 (GRCm39) missense probably damaging 1.00
IGL03347:Unc80 APN 1 66,734,625 (GRCm39) missense probably damaging 1.00
R0012:Unc80 UTSW 1 66,546,550 (GRCm39) missense probably damaging 1.00
R0012:Unc80 UTSW 1 66,546,550 (GRCm39) missense probably damaging 1.00
R0026:Unc80 UTSW 1 66,560,743 (GRCm39) missense probably benign 0.27
R0055:Unc80 UTSW 1 66,545,782 (GRCm39) splice site probably benign
R0149:Unc80 UTSW 1 66,560,760 (GRCm39) missense possibly damaging 0.82
R0325:Unc80 UTSW 1 66,550,040 (GRCm39) missense probably damaging 1.00
R0329:Unc80 UTSW 1 66,713,246 (GRCm39) missense possibly damaging 0.96
R0330:Unc80 UTSW 1 66,713,246 (GRCm39) missense possibly damaging 0.96
R0355:Unc80 UTSW 1 66,589,015 (GRCm39) missense possibly damaging 0.77
R0412:Unc80 UTSW 1 66,590,096 (GRCm39) splice site probably benign
R0422:Unc80 UTSW 1 66,522,497 (GRCm39) missense probably damaging 1.00
R0477:Unc80 UTSW 1 66,609,160 (GRCm39) missense probably damaging 0.99
R0507:Unc80 UTSW 1 66,567,052 (GRCm39) missense possibly damaging 0.66
R0513:Unc80 UTSW 1 66,661,633 (GRCm39) missense possibly damaging 0.73
R0553:Unc80 UTSW 1 66,545,828 (GRCm39) missense probably damaging 0.97
R0626:Unc80 UTSW 1 66,647,601 (GRCm39) missense probably benign 0.01
R0655:Unc80 UTSW 1 66,542,940 (GRCm39) missense probably damaging 0.98
R0742:Unc80 UTSW 1 66,567,052 (GRCm39) missense possibly damaging 0.66
R0755:Unc80 UTSW 1 66,544,082 (GRCm39) missense probably damaging 1.00
R0782:Unc80 UTSW 1 66,661,740 (GRCm39) missense possibly damaging 0.53
R0837:Unc80 UTSW 1 66,688,103 (GRCm39) missense possibly damaging 0.73
R0841:Unc80 UTSW 1 66,511,247 (GRCm39) missense probably damaging 1.00
R0893:Unc80 UTSW 1 66,560,645 (GRCm39) missense probably damaging 0.97
R0900:Unc80 UTSW 1 66,710,757 (GRCm39) missense probably benign 0.33
R0924:Unc80 UTSW 1 66,549,800 (GRCm39) missense possibly damaging 0.95
R0930:Unc80 UTSW 1 66,549,800 (GRCm39) missense possibly damaging 0.95
R0989:Unc80 UTSW 1 66,685,599 (GRCm39) missense possibly damaging 0.53
R1145:Unc80 UTSW 1 66,511,247 (GRCm39) missense probably damaging 1.00
R1145:Unc80 UTSW 1 66,511,247 (GRCm39) missense probably damaging 1.00
R1224:Unc80 UTSW 1 66,511,139 (GRCm39) missense probably damaging 1.00
R1240:Unc80 UTSW 1 66,675,061 (GRCm39) missense possibly damaging 0.85
R1245:Unc80 UTSW 1 66,594,254 (GRCm39) missense possibly damaging 0.94
R1467:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1473:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1500:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1556:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R1562:Unc80 UTSW 1 66,677,116 (GRCm39) missense probably damaging 1.00
R1655:Unc80 UTSW 1 66,711,915 (GRCm39) missense possibly damaging 0.86
R1674:Unc80 UTSW 1 66,548,467 (GRCm39) missense probably damaging 1.00
R1680:Unc80 UTSW 1 66,542,828 (GRCm39) nonsense probably null
R1739:Unc80 UTSW 1 66,567,051 (GRCm39) missense probably damaging 0.97
R1756:Unc80 UTSW 1 66,678,407 (GRCm39) missense possibly damaging 0.53
R1783:Unc80 UTSW 1 66,722,432 (GRCm39) missense probably benign 0.01
R1834:Unc80 UTSW 1 66,678,407 (GRCm39) missense possibly damaging 0.53
R1854:Unc80 UTSW 1 66,670,573 (GRCm39) missense possibly damaging 0.93
R1871:Unc80 UTSW 1 66,549,876 (GRCm39) missense possibly damaging 0.77
R1878:Unc80 UTSW 1 66,548,561 (GRCm39) missense probably damaging 0.96
R1883:Unc80 UTSW 1 66,564,929 (GRCm39) missense possibly damaging 0.89
R1912:Unc80 UTSW 1 66,549,784 (GRCm39) missense probably damaging 1.00
R1990:Unc80 UTSW 1 66,731,708 (GRCm39) missense probably damaging 0.97
R2007:Unc80 UTSW 1 66,542,935 (GRCm39) missense probably damaging 1.00
R2035:Unc80 UTSW 1 66,645,752 (GRCm39) missense probably damaging 0.98
R2056:Unc80 UTSW 1 66,679,711 (GRCm39) missense possibly damaging 0.72
R2060:Unc80 UTSW 1 66,679,754 (GRCm39) missense possibly damaging 0.53
R2074:Unc80 UTSW 1 66,718,903 (GRCm39) critical splice donor site probably null
R2088:Unc80 UTSW 1 66,629,386 (GRCm39) missense possibly damaging 0.77
R2089:Unc80 UTSW 1 66,710,874 (GRCm39) splice site probably benign
R2091:Unc80 UTSW 1 66,710,874 (GRCm39) splice site probably benign
R2139:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R2169:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R2175:Unc80 UTSW 1 66,716,514 (GRCm39) missense probably damaging 1.00
R2248:Unc80 UTSW 1 66,662,365 (GRCm39) splice site probably benign
R2255:Unc80 UTSW 1 66,657,417 (GRCm39) missense possibly damaging 0.53
R2308:Unc80 UTSW 1 66,688,156 (GRCm39) missense possibly damaging 0.53
R2484:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
R2507:Unc80 UTSW 1 66,651,266 (GRCm39) missense possibly damaging 0.53
R2512:Unc80 UTSW 1 66,710,767 (GRCm39) missense possibly damaging 0.70
R2878:Unc80 UTSW 1 66,710,735 (GRCm39) critical splice acceptor site probably benign
R3040:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3104:Unc80 UTSW 1 66,662,450 (GRCm39) missense probably benign 0.33
R3402:Unc80 UTSW 1 66,549,845 (GRCm39) missense probably damaging 0.97
R3403:Unc80 UTSW 1 66,549,845 (GRCm39) missense probably damaging 0.97
R3413:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3426:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3427:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3428:Unc80 UTSW 1 66,678,464 (GRCm39) missense probably benign 0.33
R3904:Unc80 UTSW 1 66,678,455 (GRCm39) nonsense probably null
R3916:Unc80 UTSW 1 66,716,654 (GRCm39) missense probably benign 0.11
R3950:Unc80 UTSW 1 66,661,729 (GRCm39) missense possibly damaging 0.53
R4642:Unc80 UTSW 1 66,710,873 (GRCm39) splice site probably null
R4646:Unc80 UTSW 1 66,708,394 (GRCm39) missense probably benign 0.03
R4655:Unc80 UTSW 1 66,710,821 (GRCm39) missense probably benign 0.18
R4662:Unc80 UTSW 1 66,685,595 (GRCm39) missense probably benign 0.01
R4720:Unc80 UTSW 1 66,549,951 (GRCm39) missense possibly damaging 0.92
R4736:Unc80 UTSW 1 66,688,831 (GRCm39) critical splice acceptor site probably null
R4795:Unc80 UTSW 1 66,567,100 (GRCm39) missense probably damaging 0.97
R4888:Unc80 UTSW 1 66,683,606 (GRCm39) missense probably damaging 0.98
R4917:Unc80 UTSW 1 66,685,709 (GRCm39) missense possibly damaging 0.86
R4918:Unc80 UTSW 1 66,685,709 (GRCm39) missense possibly damaging 0.86
R4983:Unc80 UTSW 1 66,713,891 (GRCm39) splice site probably null
R5051:Unc80 UTSW 1 66,548,636 (GRCm39) missense probably damaging 0.96
R5111:Unc80 UTSW 1 66,567,154 (GRCm39) missense possibly damaging 0.66
R5122:Unc80 UTSW 1 66,718,749 (GRCm39) missense possibly damaging 0.53
R5260:Unc80 UTSW 1 66,685,746 (GRCm39) missense possibly damaging 0.53
R5351:Unc80 UTSW 1 66,645,672 (GRCm39) missense possibly damaging 0.73
R5387:Unc80 UTSW 1 66,569,180 (GRCm39) missense possibly damaging 0.77
R5437:Unc80 UTSW 1 66,693,737 (GRCm39) missense possibly damaging 0.96
R5525:Unc80 UTSW 1 66,645,773 (GRCm39) missense possibly damaging 0.72
R5621:Unc80 UTSW 1 66,677,202 (GRCm39) missense possibly damaging 0.53
R5690:Unc80 UTSW 1 66,679,731 (GRCm39) missense probably benign 0.08
R5762:Unc80 UTSW 1 66,732,955 (GRCm39) missense possibly damaging 0.82
R5956:Unc80 UTSW 1 66,567,123 (GRCm39) missense probably damaging 0.97
R6005:Unc80 UTSW 1 66,666,416 (GRCm39) missense possibly damaging 0.53
R6025:Unc80 UTSW 1 66,734,727 (GRCm39) missense possibly damaging 0.90
R6033:Unc80 UTSW 1 66,512,419 (GRCm39) missense possibly damaging 0.92
R6033:Unc80 UTSW 1 66,512,419 (GRCm39) missense possibly damaging 0.92
R6117:Unc80 UTSW 1 66,714,226 (GRCm39) missense possibly damaging 0.72
R6156:Unc80 UTSW 1 66,651,409 (GRCm39) missense probably benign 0.01
R6157:Unc80 UTSW 1 66,693,188 (GRCm39) nonsense probably null
R6189:Unc80 UTSW 1 66,716,630 (GRCm39) missense probably benign 0.33
R6291:Unc80 UTSW 1 66,560,756 (GRCm39) missense possibly damaging 0.82
R6367:Unc80 UTSW 1 66,711,925 (GRCm39) missense probably benign 0.33
R6598:Unc80 UTSW 1 66,507,699 (GRCm39) critical splice donor site probably null
R6724:Unc80 UTSW 1 66,722,350 (GRCm39) missense possibly damaging 0.90
R6763:Unc80 UTSW 1 66,560,636 (GRCm39) missense probably benign 0.00
R6773:Unc80 UTSW 1 66,690,702 (GRCm39) missense probably benign 0.33
R6883:Unc80 UTSW 1 66,685,563 (GRCm39) missense probably benign 0.33
R6951:Unc80 UTSW 1 66,687,670 (GRCm39) missense possibly damaging 0.53
R6965:Unc80 UTSW 1 66,685,725 (GRCm39) missense probably benign 0.33
R6993:Unc80 UTSW 1 66,588,952 (GRCm39) missense possibly damaging 0.60
R7041:Unc80 UTSW 1 66,542,752 (GRCm39) missense probably benign 0.00
R7050:Unc80 UTSW 1 66,590,067 (GRCm39) splice site probably null
R7067:Unc80 UTSW 1 66,685,731 (GRCm39) missense possibly damaging 0.86
R7080:Unc80 UTSW 1 66,685,680 (GRCm39) missense possibly damaging 0.53
R7193:Unc80 UTSW 1 66,588,943 (GRCm39) missense possibly damaging 0.60
R7197:Unc80 UTSW 1 66,560,725 (GRCm39) nonsense probably null
R7278:Unc80 UTSW 1 66,591,368 (GRCm39) missense possibly damaging 0.82
R7290:Unc80 UTSW 1 66,640,356 (GRCm39) missense probably damaging 0.97
R7391:Unc80 UTSW 1 66,734,687 (GRCm39) missense probably benign 0.18
R7401:Unc80 UTSW 1 66,685,574 (GRCm39) missense possibly damaging 0.96
R7470:Unc80 UTSW 1 66,661,621 (GRCm39) missense probably benign 0.02
R7573:Unc80 UTSW 1 66,560,696 (GRCm39) missense probably damaging 1.00
R7637:Unc80 UTSW 1 66,711,843 (GRCm39) missense possibly damaging 0.86
R7678:Unc80 UTSW 1 66,688,881 (GRCm39) missense probably benign 0.33
R7697:Unc80 UTSW 1 66,677,104 (GRCm39) missense possibly damaging 0.93
R7746:Unc80 UTSW 1 66,716,544 (GRCm39) missense probably benign 0.33
R7768:Unc80 UTSW 1 66,549,754 (GRCm39) missense possibly damaging 0.56
R7796:Unc80 UTSW 1 66,542,873 (GRCm39) missense probably benign
R7855:Unc80 UTSW 1 66,522,508 (GRCm39) missense possibly damaging 0.78
R7878:Unc80 UTSW 1 66,640,300 (GRCm39) missense possibly damaging 0.88
R7879:Unc80 UTSW 1 66,549,866 (GRCm39) missense probably benign 0.00
R8024:Unc80 UTSW 1 66,645,803 (GRCm39) missense possibly damaging 0.86
R8026:Unc80 UTSW 1 66,522,463 (GRCm39) missense possibly damaging 0.92
R8115:Unc80 UTSW 1 66,688,072 (GRCm39) missense probably benign 0.00
R8135:Unc80 UTSW 1 66,548,446 (GRCm39) missense possibly damaging 0.49
R8170:Unc80 UTSW 1 66,690,692 (GRCm39) missense probably benign 0.33
R8239:Unc80 UTSW 1 66,693,178 (GRCm39) missense probably benign
R8249:Unc80 UTSW 1 66,658,650 (GRCm39) missense probably benign 0.01
R8275:Unc80 UTSW 1 66,679,773 (GRCm39) nonsense probably null
R8341:Unc80 UTSW 1 66,688,192 (GRCm39) missense possibly damaging 0.73
R8356:Unc80 UTSW 1 66,680,788 (GRCm39) missense possibly damaging 0.85
R8433:Unc80 UTSW 1 66,677,187 (GRCm39) nonsense probably null
R8456:Unc80 UTSW 1 66,680,788 (GRCm39) missense possibly damaging 0.85
R8464:Unc80 UTSW 1 66,512,423 (GRCm39) missense probably damaging 1.00
R8483:Unc80 UTSW 1 66,732,869 (GRCm39) missense possibly damaging 0.83
R8509:Unc80 UTSW 1 66,680,788 (GRCm39) missense possibly damaging 0.85
R8686:Unc80 UTSW 1 66,651,427 (GRCm39) missense possibly damaging 0.53
R8701:Unc80 UTSW 1 66,677,191 (GRCm39) missense possibly damaging 0.85
R8729:Unc80 UTSW 1 66,647,649 (GRCm39) missense probably benign 0.01
R8755:Unc80 UTSW 1 66,651,290 (GRCm39) missense possibly damaging 0.53
R8771:Unc80 UTSW 1 66,685,554 (GRCm39) missense possibly damaging 0.85
R8866:Unc80 UTSW 1 66,629,388 (GRCm39) missense probably benign 0.05
R8877:Unc80 UTSW 1 66,567,144 (GRCm39) missense possibly damaging 0.89
R8942:Unc80 UTSW 1 66,512,468 (GRCm39) missense possibly damaging 0.94
R8976:Unc80 UTSW 1 66,511,169 (GRCm39) missense possibly damaging 0.87
R9063:Unc80 UTSW 1 66,645,816 (GRCm39) critical splice donor site probably null
R9095:Unc80 UTSW 1 66,545,912 (GRCm39) missense probably damaging 1.00
R9125:Unc80 UTSW 1 66,718,740 (GRCm39) missense probably benign 0.18
R9130:Unc80 UTSW 1 66,677,244 (GRCm39) missense possibly damaging 0.85
R9165:Unc80 UTSW 1 66,589,000 (GRCm39) missense probably null 0.95
R9220:Unc80 UTSW 1 66,546,534 (GRCm39) missense probably damaging 1.00
R9262:Unc80 UTSW 1 66,594,411 (GRCm39) intron probably benign
R9334:Unc80 UTSW 1 66,688,919 (GRCm39) missense possibly damaging 0.73
R9374:Unc80 UTSW 1 66,629,460 (GRCm39) missense possibly damaging 0.95
R9387:Unc80 UTSW 1 66,589,097 (GRCm39) critical splice donor site probably null
R9415:Unc80 UTSW 1 66,550,064 (GRCm39) missense
R9427:Unc80 UTSW 1 66,594,158 (GRCm39) missense probably damaging 1.00
R9436:Unc80 UTSW 1 66,732,964 (GRCm39) critical splice donor site probably null
R9454:Unc80 UTSW 1 66,734,749 (GRCm39) missense possibly damaging 0.53
R9522:Unc80 UTSW 1 66,677,221 (GRCm39) missense possibly damaging 0.73
R9539:Unc80 UTSW 1 66,609,163 (GRCm39) critical splice donor site probably null
R9552:Unc80 UTSW 1 66,717,282 (GRCm39) missense possibly damaging 0.85
R9667:Unc80 UTSW 1 66,651,287 (GRCm39) missense possibly damaging 0.86
R9720:Unc80 UTSW 1 66,683,485 (GRCm39) missense possibly damaging 0.53
R9749:Unc80 UTSW 1 66,544,179 (GRCm39) missense probably damaging 0.99
R9789:Unc80 UTSW 1 66,651,371 (GRCm39) missense possibly damaging 0.53
X0019:Unc80 UTSW 1 66,687,541 (GRCm39) missense probably benign 0.33
X0021:Unc80 UTSW 1 66,548,425 (GRCm39) critical splice acceptor site probably null
X0024:Unc80 UTSW 1 66,530,205 (GRCm39) missense probably benign 0.21
X0062:Unc80 UTSW 1 66,662,418 (GRCm39) missense probably benign 0.02
X0066:Unc80 UTSW 1 66,569,916 (GRCm39) missense possibly damaging 0.77
Y4335:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
Y4336:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
Y4338:Unc80 UTSW 1 66,560,740 (GRCm39) missense possibly damaging 0.46
Z1088:Unc80 UTSW 1 66,685,610 (GRCm39) missense possibly damaging 0.85
Z1176:Unc80 UTSW 1 66,733,568 (GRCm39) missense probably benign
Z1177:Unc80 UTSW 1 66,734,498 (GRCm39) missense probably benign 0.03
Z1177:Unc80 UTSW 1 66,685,557 (GRCm39) missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GTCATATCCACTATTCTGGGCAC -3'
(R):5'- TATCGCATCCCACGGGTAAC -3'

Sequencing Primer
(F):5'- GGGCACATAATTTACCTTTACCTG -3'
(R):5'- ACCTTTATCCTGTGCACCAAAGG -3'
Posted On 2020-07-28