Incidental Mutation 'R8288:Scn7a'
ID 638514
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Name sodium channel, voltage-gated, type VII, alpha
Synonyms 1110034K09Rik, NaG, Nav2, Nax, Nav2.3, Scn6a
MMRRC Submission 067710-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R8288 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 66503770-66615254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 66506318 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 1524 (R1524W)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
AlphaFold B1AYL1
Predicted Effect probably damaging
Transcript: ENSMUST00000042792
AA Change: R1524W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: R1524W

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 C T 8: 23,283,153 (GRCm39) A200T probably benign Het
Arpp19 T C 9: 74,944,914 (GRCm39) M1T probably null Het
Baiap2 T A 11: 119,888,465 (GRCm39) V407E probably damaging Het
Cdh18 A G 15: 23,446,073 (GRCm39) T508A probably damaging Het
Cnnm3 C A 1: 36,551,074 (GRCm39) A28E possibly damaging Het
Cpb1 A T 3: 20,319,531 (GRCm39) C184* probably null Het
Ddb1 T C 19: 10,585,712 (GRCm39) V142A probably benign Het
Disp2 T C 2: 118,620,762 (GRCm39) V498A probably damaging Het
Dmgdh T C 13: 93,845,332 (GRCm39) Y442H probably damaging Het
Dync2i1 A G 12: 116,177,345 (GRCm39) F811S probably damaging Het
Eef2k T A 7: 120,502,604 (GRCm39) M722K probably damaging Het
Erbb4 A G 1: 68,337,509 (GRCm39) F603S probably damaging Het
Filip1l C T 16: 57,390,917 (GRCm39) R502C probably damaging Het
Gbp9 C T 5: 105,253,599 (GRCm39) V39M probably damaging Het
Gm17079 T C 14: 51,931,815 (GRCm39) Y98C Het
Gstz1 A G 12: 87,194,604 (GRCm39) M1V probably null Het
Hsd17b13 T G 5: 104,111,701 (GRCm39) I281L probably benign Het
Hydin A G 8: 111,233,661 (GRCm39) E1833G probably damaging Het
Irs1 G A 1: 82,265,682 (GRCm39) Q845* probably null Het
Kctd11 C T 11: 69,770,883 (GRCm39) G52R probably damaging Het
Kit T C 5: 75,815,149 (GRCm39) S962P probably damaging Het
Lrrn1 C T 6: 107,543,955 (GRCm39) probably benign Het
Mastl T C 2: 23,023,371 (GRCm39) K451E probably damaging Het
Mptx2 A G 1: 173,102,356 (GRCm39) V111A probably benign Het
Nuak2 G T 1: 132,255,579 (GRCm39) C178F probably damaging Het
Pah G A 10: 87,374,047 (GRCm39) R71H probably benign Het
Pclo C A 5: 14,762,885 (GRCm39) T501K Het
Pla2g4e C T 2: 120,018,990 (GRCm39) probably null Het
Polq A G 16: 36,848,272 (GRCm39) E293G probably damaging Het
Rptor G A 11: 119,748,763 (GRCm39) E782K probably benign Het
Slc4a5 T C 6: 83,203,237 (GRCm39) S46P probably benign Het
Srcap T A 7: 127,130,528 (GRCm39) I664N probably damaging Het
Stk24 A C 14: 121,530,841 (GRCm39) F372V possibly damaging Het
Szt2 T C 4: 118,246,973 (GRCm39) S881G probably damaging Het
Trim40 T C 17: 37,194,210 (GRCm39) D161G probably benign Het
Trip11 T C 12: 101,860,643 (GRCm39) H234R possibly damaging Het
Trpc1 T C 9: 95,603,434 (GRCm39) K366R probably damaging Het
Ugt2b35 T C 5: 87,149,316 (GRCm39) L189P probably damaging Het
Unc80 A G 1: 66,512,509 (GRCm39) S140G probably benign Het
Zfp446 A G 7: 12,711,885 (GRCm39) E36G probably benign Het
Zfp738 T A 13: 67,818,908 (GRCm39) H361L possibly damaging Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66,513,671 (GRCm39) splice site probably benign
IGL00432:Scn7a APN 2 66,572,326 (GRCm39) nonsense probably null
IGL00720:Scn7a APN 2 66,506,388 (GRCm39) missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00784:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00926:Scn7a APN 2 66,514,475 (GRCm39) missense probably benign 0.06
IGL00963:Scn7a APN 2 66,534,289 (GRCm39) splice site probably benign
IGL01099:Scn7a APN 2 66,514,582 (GRCm39) missense probably damaging 1.00
IGL01326:Scn7a APN 2 66,582,604 (GRCm39) missense probably benign 0.13
IGL01538:Scn7a APN 2 66,534,196 (GRCm39) missense probably benign
IGL01624:Scn7a APN 2 66,582,269 (GRCm39) missense probably benign 0.07
IGL01794:Scn7a APN 2 66,505,853 (GRCm39) missense probably benign
IGL02100:Scn7a APN 2 66,505,843 (GRCm39) makesense probably null
IGL02326:Scn7a APN 2 66,530,392 (GRCm39) missense probably benign 0.00
IGL02472:Scn7a APN 2 66,582,658 (GRCm39) missense probably damaging 1.00
IGL02528:Scn7a APN 2 66,530,519 (GRCm39) missense probably damaging 1.00
IGL02798:Scn7a APN 2 66,544,219 (GRCm39) missense probably benign 0.00
IGL03026:Scn7a APN 2 66,506,442 (GRCm39) missense probably damaging 0.99
IGL03071:Scn7a APN 2 66,530,291 (GRCm39) missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66,528,160 (GRCm39) missense probably benign 0.01
IGL03180:Scn7a APN 2 66,506,578 (GRCm39) missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66,506,304 (GRCm39) missense probably benign 0.00
alert UTSW 2 66,510,590 (GRCm39) nonsense probably null
glimmer UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
Uptick UTSW 2 66,530,393 (GRCm39) nonsense probably null
PIT4514001:Scn7a UTSW 2 66,514,523 (GRCm39) missense probably damaging 1.00
R0004:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66,544,381 (GRCm39) missense probably benign 0.04
R0230:Scn7a UTSW 2 66,556,628 (GRCm39) missense probably damaging 1.00
R0463:Scn7a UTSW 2 66,506,084 (GRCm39) missense probably benign 0.05
R0846:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66,510,639 (GRCm39) missense probably damaging 0.98
R1282:Scn7a UTSW 2 66,531,193 (GRCm39) missense probably damaging 0.98
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1501:Scn7a UTSW 2 66,530,507 (GRCm39) missense probably benign 0.37
R1672:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66,506,287 (GRCm39) missense probably damaging 0.99
R1712:Scn7a UTSW 2 66,535,447 (GRCm39) missense probably benign 0.05
R1758:Scn7a UTSW 2 66,531,231 (GRCm39) missense probably damaging 0.97
R1758:Scn7a UTSW 2 66,510,527 (GRCm39) missense probably benign 0.00
R1775:Scn7a UTSW 2 66,511,299 (GRCm39) missense probably benign 0.02
R1848:Scn7a UTSW 2 66,514,357 (GRCm39) critical splice donor site probably null
R1851:Scn7a UTSW 2 66,510,635 (GRCm39) missense probably benign
R1919:Scn7a UTSW 2 66,530,317 (GRCm39) missense probably damaging 1.00
R1932:Scn7a UTSW 2 66,506,446 (GRCm39) missense probably damaging 1.00
R1945:Scn7a UTSW 2 66,506,324 (GRCm39) missense probably damaging 1.00
R1970:Scn7a UTSW 2 66,514,633 (GRCm39) missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66,513,613 (GRCm39) missense probably damaging 0.99
R2008:Scn7a UTSW 2 66,518,091 (GRCm39) missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66,567,780 (GRCm39) missense probably damaging 1.00
R2113:Scn7a UTSW 2 66,506,312 (GRCm39) missense probably damaging 1.00
R2128:Scn7a UTSW 2 66,528,330 (GRCm39) missense probably damaging 0.99
R2163:Scn7a UTSW 2 66,506,300 (GRCm39) missense probably damaging 0.97
R2421:Scn7a UTSW 2 66,556,646 (GRCm39) splice site probably benign
R2446:Scn7a UTSW 2 66,523,002 (GRCm39) missense probably damaging 0.98
R2922:Scn7a UTSW 2 66,530,551 (GRCm39) splice site probably benign
R3015:Scn7a UTSW 2 66,530,240 (GRCm39) missense probably benign 0.08
R3034:Scn7a UTSW 2 66,513,152 (GRCm39) missense probably damaging 1.00
R3419:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3429:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3430:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3434:Scn7a UTSW 2 66,505,847 (GRCm39) missense probably benign 0.01
R3803:Scn7a UTSW 2 66,510,590 (GRCm39) nonsense probably null
R3831:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R3833:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R4017:Scn7a UTSW 2 66,572,329 (GRCm39) missense probably damaging 1.00
R4244:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4245:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4276:Scn7a UTSW 2 66,514,407 (GRCm39) missense probably damaging 0.97
R4307:Scn7a UTSW 2 66,506,099 (GRCm39) missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66,567,815 (GRCm39) missense probably damaging 1.00
R4353:Scn7a UTSW 2 66,506,780 (GRCm39) missense probably benign 0.00
R4721:Scn7a UTSW 2 66,514,529 (GRCm39) missense probably damaging 1.00
R4722:Scn7a UTSW 2 66,531,228 (GRCm39) missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66,534,104 (GRCm39) missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66,556,592 (GRCm39) missense probably damaging 1.00
R5362:Scn7a UTSW 2 66,530,342 (GRCm39) missense probably damaging 1.00
R5437:Scn7a UTSW 2 66,506,690 (GRCm39) missense probably damaging 1.00
R5729:Scn7a UTSW 2 66,572,301 (GRCm39) critical splice donor site probably null
R5777:Scn7a UTSW 2 66,522,913 (GRCm39) missense probably damaging 1.00
R5785:Scn7a UTSW 2 66,527,912 (GRCm39) missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
R5830:Scn7a UTSW 2 66,544,395 (GRCm39) nonsense probably null
R5877:Scn7a UTSW 2 66,530,217 (GRCm39) nonsense probably null
R5881:Scn7a UTSW 2 66,505,870 (GRCm39) missense probably benign 0.01
R5967:Scn7a UTSW 2 66,506,057 (GRCm39) missense probably damaging 1.00
R5988:Scn7a UTSW 2 66,556,558 (GRCm39) nonsense probably null
R6077:Scn7a UTSW 2 66,527,940 (GRCm39) missense probably damaging 1.00
R6135:Scn7a UTSW 2 66,534,244 (GRCm39) missense probably benign
R6242:Scn7a UTSW 2 66,531,110 (GRCm39) missense probably benign 0.00
R6264:Scn7a UTSW 2 66,505,870 (GRCm39) missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66,530,458 (GRCm39) missense probably damaging 0.98
R6544:Scn7a UTSW 2 66,514,444 (GRCm39) missense probably damaging 1.00
R6770:Scn7a UTSW 2 66,559,528 (GRCm39) splice site probably null
R6997:Scn7a UTSW 2 66,534,147 (GRCm39) missense probably damaging 1.00
R7014:Scn7a UTSW 2 66,572,303 (GRCm39) missense probably null 1.00
R7126:Scn7a UTSW 2 66,587,630 (GRCm39) missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66,530,537 (GRCm39) missense probably benign 0.14
R7176:Scn7a UTSW 2 66,506,632 (GRCm39) missense probably damaging 1.00
R7185:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66,587,506 (GRCm39) missense probably damaging 1.00
R7332:Scn7a UTSW 2 66,522,898 (GRCm39) nonsense probably null
R7421:Scn7a UTSW 2 66,505,876 (GRCm39) missense probably benign 0.07
R7488:Scn7a UTSW 2 66,587,574 (GRCm39) missense probably benign 0.16
R7636:Scn7a UTSW 2 66,574,172 (GRCm39) missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66,506,536 (GRCm39) missense probably damaging 1.00
R7711:Scn7a UTSW 2 66,531,221 (GRCm39) missense probably damaging 1.00
R7813:Scn7a UTSW 2 66,506,689 (GRCm39) missense probably damaging 1.00
R7833:Scn7a UTSW 2 66,506,494 (GRCm39) missense probably damaging 1.00
R7914:Scn7a UTSW 2 66,530,294 (GRCm39) missense probably damaging 0.97
R7953:Scn7a UTSW 2 66,587,670 (GRCm39) missense possibly damaging 0.90
R7970:Scn7a UTSW 2 66,506,173 (GRCm39) missense probably damaging 1.00
R8061:Scn7a UTSW 2 66,522,938 (GRCm39) missense probably damaging 1.00
R8121:Scn7a UTSW 2 66,531,203 (GRCm39) missense probably damaging 1.00
R8172:Scn7a UTSW 2 66,506,191 (GRCm39) missense possibly damaging 0.90
R8209:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8226:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8431:Scn7a UTSW 2 66,534,164 (GRCm39) missense possibly damaging 0.62
R8678:Scn7a UTSW 2 66,574,041 (GRCm39) splice site probably benign
R8745:Scn7a UTSW 2 66,510,526 (GRCm39) missense probably benign
R8781:Scn7a UTSW 2 66,567,775 (GRCm39) missense probably benign 0.03
R8848:Scn7a UTSW 2 66,530,393 (GRCm39) nonsense probably null
R8878:Scn7a UTSW 2 66,506,199 (GRCm39) missense probably damaging 1.00
R8943:Scn7a UTSW 2 66,525,206 (GRCm39) synonymous silent
R8991:Scn7a UTSW 2 66,514,588 (GRCm39) missense possibly damaging 0.65
R9147:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9148:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9402:Scn7a UTSW 2 66,510,456 (GRCm39) missense probably damaging 1.00
R9501:Scn7a UTSW 2 66,582,579 (GRCm39) missense probably benign 0.00
R9546:Scn7a UTSW 2 66,582,603 (GRCm39) missense possibly damaging 0.93
R9715:Scn7a UTSW 2 66,519,902 (GRCm39) missense possibly damaging 0.93
X0060:Scn7a UTSW 2 66,520,026 (GRCm39) missense probably benign 0.01
X0066:Scn7a UTSW 2 66,510,536 (GRCm39) missense probably benign
Z1088:Scn7a UTSW 2 66,544,295 (GRCm39) missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66,582,613 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACCCGGATTCTATCTCTGAAAG -3'
(R):5'- AGATTGTGGGAGCCCTTCTG -3'

Sequencing Primer
(F):5'- CCATCACTCTTTTCGTAAAGGCAAG -3'
(R):5'- GAGCCCTTCTGTTGGGATTTC -3'
Posted On 2020-07-28