Incidental Mutation 'R8288:Pla2g4e'
ID 638516
Institutional Source Beutler Lab
Gene Symbol Pla2g4e
Ensembl Gene ENSMUSG00000050211
Gene Name phospholipase A2, group IVE
Synonyms Pla2epsilon, 2310026J01Rik
MMRRC Submission 067710-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8288 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 119996893-120075816 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 120018990 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090071]
AlphaFold Q50L42
Predicted Effect probably null
Transcript: ENSMUST00000090071
SMART Domains Protein: ENSMUSP00000087525
Gene: ENSMUSG00000050211

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
C2 82 182 3.42e-14 SMART
low complexity region 191 207 N/A INTRINSIC
PLAc 311 818 5.17e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytosolic phospholipase A2 group IV family. Members of this family are involved in regulation of membrane tubule-mediated transport. The enzyme encoded by this member of the family plays a role in trafficking through the clathrin-independent endocytic pathway. The enzyme regulates the recycling process via formation of tubules that transport internalized clathrin-independent cargo proteins back to the cell surface. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 C T 8: 23,283,153 (GRCm39) A200T probably benign Het
Arpp19 T C 9: 74,944,914 (GRCm39) M1T probably null Het
Baiap2 T A 11: 119,888,465 (GRCm39) V407E probably damaging Het
Cdh18 A G 15: 23,446,073 (GRCm39) T508A probably damaging Het
Cnnm3 C A 1: 36,551,074 (GRCm39) A28E possibly damaging Het
Cpb1 A T 3: 20,319,531 (GRCm39) C184* probably null Het
Ddb1 T C 19: 10,585,712 (GRCm39) V142A probably benign Het
Disp2 T C 2: 118,620,762 (GRCm39) V498A probably damaging Het
Dmgdh T C 13: 93,845,332 (GRCm39) Y442H probably damaging Het
Dync2i1 A G 12: 116,177,345 (GRCm39) F811S probably damaging Het
Eef2k T A 7: 120,502,604 (GRCm39) M722K probably damaging Het
Erbb4 A G 1: 68,337,509 (GRCm39) F603S probably damaging Het
Filip1l C T 16: 57,390,917 (GRCm39) R502C probably damaging Het
Gbp9 C T 5: 105,253,599 (GRCm39) V39M probably damaging Het
Gm17079 T C 14: 51,931,815 (GRCm39) Y98C Het
Gstz1 A G 12: 87,194,604 (GRCm39) M1V probably null Het
Hsd17b13 T G 5: 104,111,701 (GRCm39) I281L probably benign Het
Hydin A G 8: 111,233,661 (GRCm39) E1833G probably damaging Het
Irs1 G A 1: 82,265,682 (GRCm39) Q845* probably null Het
Kctd11 C T 11: 69,770,883 (GRCm39) G52R probably damaging Het
Kit T C 5: 75,815,149 (GRCm39) S962P probably damaging Het
Lrrn1 C T 6: 107,543,955 (GRCm39) probably benign Het
Mastl T C 2: 23,023,371 (GRCm39) K451E probably damaging Het
Mptx2 A G 1: 173,102,356 (GRCm39) V111A probably benign Het
Nuak2 G T 1: 132,255,579 (GRCm39) C178F probably damaging Het
Pah G A 10: 87,374,047 (GRCm39) R71H probably benign Het
Pclo C A 5: 14,762,885 (GRCm39) T501K Het
Polq A G 16: 36,848,272 (GRCm39) E293G probably damaging Het
Rptor G A 11: 119,748,763 (GRCm39) E782K probably benign Het
Scn7a T A 2: 66,506,318 (GRCm39) R1524W probably damaging Het
Slc4a5 T C 6: 83,203,237 (GRCm39) S46P probably benign Het
Srcap T A 7: 127,130,528 (GRCm39) I664N probably damaging Het
Stk24 A C 14: 121,530,841 (GRCm39) F372V possibly damaging Het
Szt2 T C 4: 118,246,973 (GRCm39) S881G probably damaging Het
Trim40 T C 17: 37,194,210 (GRCm39) D161G probably benign Het
Trip11 T C 12: 101,860,643 (GRCm39) H234R possibly damaging Het
Trpc1 T C 9: 95,603,434 (GRCm39) K366R probably damaging Het
Ugt2b35 T C 5: 87,149,316 (GRCm39) L189P probably damaging Het
Unc80 A G 1: 66,512,509 (GRCm39) S140G probably benign Het
Zfp446 A G 7: 12,711,885 (GRCm39) E36G probably benign Het
Zfp738 T A 13: 67,818,908 (GRCm39) H361L possibly damaging Het
Other mutations in Pla2g4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Pla2g4e APN 2 120,015,719 (GRCm39) missense probably benign
IGL01712:Pla2g4e APN 2 120,019,884 (GRCm39) critical splice donor site probably null
IGL01859:Pla2g4e APN 2 120,013,214 (GRCm39) missense possibly damaging 0.70
IGL02334:Pla2g4e APN 2 120,017,717 (GRCm39) missense probably benign
FR4737:Pla2g4e UTSW 2 120,075,205 (GRCm39) small deletion probably benign
R0157:Pla2g4e UTSW 2 120,000,662 (GRCm39) missense probably benign 0.00
R0578:Pla2g4e UTSW 2 120,075,162 (GRCm39) splice site probably benign
R0675:Pla2g4e UTSW 2 120,030,679 (GRCm39) splice site probably benign
R1278:Pla2g4e UTSW 2 119,998,951 (GRCm39) critical splice donor site probably null
R1346:Pla2g4e UTSW 2 120,013,253 (GRCm39) missense probably damaging 1.00
R1760:Pla2g4e UTSW 2 120,000,527 (GRCm39) missense possibly damaging 0.50
R1773:Pla2g4e UTSW 2 120,075,202 (GRCm39) missense probably benign
R1792:Pla2g4e UTSW 2 119,998,955 (GRCm39) missense probably damaging 1.00
R2129:Pla2g4e UTSW 2 120,013,292 (GRCm39) missense probably damaging 0.99
R2160:Pla2g4e UTSW 2 120,015,687 (GRCm39) missense probably benign 0.00
R2191:Pla2g4e UTSW 2 120,021,680 (GRCm39) frame shift probably null
R3901:Pla2g4e UTSW 2 119,999,085 (GRCm39) missense probably benign 0.00
R4342:Pla2g4e UTSW 2 120,016,927 (GRCm39) intron probably benign
R4414:Pla2g4e UTSW 2 120,013,194 (GRCm39) missense probably benign
R4460:Pla2g4e UTSW 2 120,016,863 (GRCm39) missense possibly damaging 0.53
R4581:Pla2g4e UTSW 2 120,016,863 (GRCm39) missense possibly damaging 0.53
R4599:Pla2g4e UTSW 2 120,016,863 (GRCm39) missense possibly damaging 0.53
R4601:Pla2g4e UTSW 2 120,016,863 (GRCm39) missense possibly damaging 0.53
R4610:Pla2g4e UTSW 2 120,016,863 (GRCm39) missense possibly damaging 0.53
R4611:Pla2g4e UTSW 2 120,016,863 (GRCm39) missense possibly damaging 0.53
R4664:Pla2g4e UTSW 2 120,001,669 (GRCm39) missense probably damaging 0.97
R4688:Pla2g4e UTSW 2 119,998,414 (GRCm39) missense possibly damaging 0.82
R4691:Pla2g4e UTSW 2 120,004,781 (GRCm39) missense probably damaging 1.00
R4944:Pla2g4e UTSW 2 120,001,718 (GRCm39) missense probably benign 0.01
R5051:Pla2g4e UTSW 2 120,004,785 (GRCm39) missense probably damaging 1.00
R5285:Pla2g4e UTSW 2 120,019,985 (GRCm39) missense probably damaging 1.00
R5373:Pla2g4e UTSW 2 120,016,876 (GRCm39) missense probably benign 0.30
R5374:Pla2g4e UTSW 2 120,016,876 (GRCm39) missense probably benign 0.30
R5505:Pla2g4e UTSW 2 120,075,256 (GRCm39) missense probably benign 0.08
R5702:Pla2g4e UTSW 2 120,018,992 (GRCm39) missense possibly damaging 0.61
R6300:Pla2g4e UTSW 2 120,013,219 (GRCm39) missense probably benign 0.00
R6711:Pla2g4e UTSW 2 120,001,751 (GRCm39) missense probably benign 0.00
R6920:Pla2g4e UTSW 2 120,015,795 (GRCm39) missense possibly damaging 0.82
R6961:Pla2g4e UTSW 2 120,004,851 (GRCm39) splice site probably null
R6987:Pla2g4e UTSW 2 120,016,861 (GRCm39) missense probably benign 0.01
R7028:Pla2g4e UTSW 2 120,000,676 (GRCm39) missense probably damaging 1.00
R7138:Pla2g4e UTSW 2 120,001,759 (GRCm39) missense probably damaging 1.00
R7300:Pla2g4e UTSW 2 120,021,680 (GRCm39) missense probably damaging 1.00
R7355:Pla2g4e UTSW 2 120,011,982 (GRCm39) missense possibly damaging 0.91
R7502:Pla2g4e UTSW 2 120,004,819 (GRCm39) splice site probably null
R7849:Pla2g4e UTSW 2 120,015,803 (GRCm39) missense probably benign 0.32
R8686:Pla2g4e UTSW 2 120,075,172 (GRCm39) missense probably damaging 0.98
R9003:Pla2g4e UTSW 2 120,007,282 (GRCm39) missense probably benign 0.03
R9023:Pla2g4e UTSW 2 120,001,718 (GRCm39) missense probably benign 0.01
R9261:Pla2g4e UTSW 2 120,019,910 (GRCm39) missense probably benign 0.04
R9284:Pla2g4e UTSW 2 120,004,730 (GRCm39) splice site probably benign
R9299:Pla2g4e UTSW 2 120,002,204 (GRCm39) missense probably damaging 1.00
R9338:Pla2g4e UTSW 2 120,019,914 (GRCm39) missense probably benign 0.07
R9555:Pla2g4e UTSW 2 120,075,400 (GRCm39) start gained probably benign
R9604:Pla2g4e UTSW 2 120,015,680 (GRCm39) missense probably benign 0.02
RF044:Pla2g4e UTSW 2 120,075,205 (GRCm39) small deletion probably benign
Z1177:Pla2g4e UTSW 2 120,012,004 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTAAAGGAATGCTGGCATCAG -3'
(R):5'- AACAGCTGTTCCTTCTCCATGG -3'

Sequencing Primer
(F):5'- GGTGGAACCTGGACACTTTAC -3'
(R):5'- CATGGCCCTAGGACCAAGTATG -3'
Posted On 2020-07-28