Incidental Mutation 'R8288:Pla2g4e'
ID 638516
Institutional Source Beutler Lab
Gene Symbol Pla2g4e
Ensembl Gene ENSMUSG00000050211
Gene Name phospholipase A2, group IVE
Synonyms Pla2epsilon, 2310026J01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8288 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 120166412-120245335 bp(-) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 120188509 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090071]
AlphaFold Q50L42
Predicted Effect probably null
Transcript: ENSMUST00000090071
SMART Domains Protein: ENSMUSP00000087525
Gene: ENSMUSG00000050211

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
C2 82 182 3.42e-14 SMART
low complexity region 191 207 N/A INTRINSIC
PLAc 311 818 5.17e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytosolic phospholipase A2 group IV family. Members of this family are involved in regulation of membrane tubule-mediated transport. The enzyme encoded by this member of the family plays a role in trafficking through the clathrin-independent endocytic pathway. The enzyme regulates the recycling process via formation of tubules that transport internalized clathrin-independent cargo proteins back to the cell surface. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 C T 8: 22,793,137 A200T probably benign Het
Arpp19 T C 9: 75,037,632 M1T probably null Het
Baiap2 T A 11: 119,997,639 V407E probably damaging Het
Cdh18 A G 15: 23,445,987 T508A probably damaging Het
Cnnm3 C A 1: 36,511,993 A28E possibly damaging Het
Cpb1 A T 3: 20,265,367 C184* probably null Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Disp2 T C 2: 118,790,281 V498A probably damaging Het
Dmgdh T C 13: 93,708,824 Y442H probably damaging Het
Eef2k T A 7: 120,903,381 M722K probably damaging Het
Erbb4 A G 1: 68,298,350 F603S probably damaging Het
Filip1l C T 16: 57,570,554 R502C probably damaging Het
Gbp9 C T 5: 105,105,733 V39M probably damaging Het
Gm17079 T C 14: 51,694,358 Y98C Het
Gstz1 A G 12: 87,147,830 M1V probably null Het
Hsd17b13 T G 5: 103,963,835 I281L probably benign Het
Hydin A G 8: 110,507,029 E1833G probably damaging Het
Irs1 G A 1: 82,287,961 Q845* probably null Het
Kctd11 C T 11: 69,880,057 G52R probably damaging Het
Kit T C 5: 75,654,489 S962P probably damaging Het
Lrrn1 C T 6: 107,566,994 probably benign Het
Mastl T C 2: 23,133,359 K451E probably damaging Het
Mptx2 A G 1: 173,274,789 V111A probably benign Het
Nuak2 G T 1: 132,327,841 C178F probably damaging Het
Pah G A 10: 87,538,185 R71H probably benign Het
Pclo C A 5: 14,712,871 T501K Het
Polq A G 16: 37,027,910 E293G probably damaging Het
Rptor G A 11: 119,857,937 E782K probably benign Het
Scn7a T A 2: 66,675,974 R1524W probably damaging Het
Slc4a5 T C 6: 83,226,255 S46P probably benign Het
Srcap T A 7: 127,531,356 I664N probably damaging Het
Stk24 A C 14: 121,293,429 F372V possibly damaging Het
Szt2 T C 4: 118,389,776 S881G probably damaging Het
Trim40 T C 17: 36,883,318 D161G probably benign Het
Trip11 T C 12: 101,894,384 H234R possibly damaging Het
Trpc1 T C 9: 95,721,381 K366R probably damaging Het
Ugt2b35 T C 5: 87,001,457 L189P probably damaging Het
Unc80 A G 1: 66,473,350 S140G probably benign Het
Wdr60 A G 12: 116,213,725 F811S probably damaging Het
Zfp446 A G 7: 12,977,958 E36G probably benign Het
Zfp738 T A 13: 67,670,789 H361L possibly damaging Het
Other mutations in Pla2g4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Pla2g4e APN 2 120185238 missense probably benign
IGL01712:Pla2g4e APN 2 120189403 critical splice donor site probably null
IGL01859:Pla2g4e APN 2 120182733 missense possibly damaging 0.70
IGL02334:Pla2g4e APN 2 120187236 missense probably benign
FR4737:Pla2g4e UTSW 2 120244724 small deletion probably benign
R0157:Pla2g4e UTSW 2 120170181 missense probably benign 0.00
R0578:Pla2g4e UTSW 2 120244681 splice site probably benign
R0675:Pla2g4e UTSW 2 120200198 splice site probably benign
R1278:Pla2g4e UTSW 2 120168470 critical splice donor site probably null
R1346:Pla2g4e UTSW 2 120182772 missense probably damaging 1.00
R1760:Pla2g4e UTSW 2 120170046 missense possibly damaging 0.50
R1773:Pla2g4e UTSW 2 120244721 missense probably benign
R1792:Pla2g4e UTSW 2 120168474 missense probably damaging 1.00
R2129:Pla2g4e UTSW 2 120182811 missense probably damaging 0.99
R2160:Pla2g4e UTSW 2 120185206 missense probably benign 0.00
R2191:Pla2g4e UTSW 2 120191199 frame shift probably null
R3901:Pla2g4e UTSW 2 120168604 missense probably benign 0.00
R4342:Pla2g4e UTSW 2 120186446 intron probably benign
R4414:Pla2g4e UTSW 2 120182713 missense probably benign
R4460:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4581:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4599:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4601:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4610:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4611:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4664:Pla2g4e UTSW 2 120171188 missense probably damaging 0.97
R4688:Pla2g4e UTSW 2 120167933 missense possibly damaging 0.82
R4691:Pla2g4e UTSW 2 120174300 missense probably damaging 1.00
R4944:Pla2g4e UTSW 2 120171237 missense probably benign 0.01
R5051:Pla2g4e UTSW 2 120174304 missense probably damaging 1.00
R5285:Pla2g4e UTSW 2 120189504 missense probably damaging 1.00
R5373:Pla2g4e UTSW 2 120186395 missense probably benign 0.30
R5374:Pla2g4e UTSW 2 120186395 missense probably benign 0.30
R5505:Pla2g4e UTSW 2 120244775 missense probably benign 0.08
R5702:Pla2g4e UTSW 2 120188511 missense possibly damaging 0.61
R6300:Pla2g4e UTSW 2 120182738 missense probably benign 0.00
R6711:Pla2g4e UTSW 2 120171270 missense probably benign 0.00
R6920:Pla2g4e UTSW 2 120185314 missense possibly damaging 0.82
R6961:Pla2g4e UTSW 2 120174370 splice site probably null
R6987:Pla2g4e UTSW 2 120186380 missense probably benign 0.01
R7028:Pla2g4e UTSW 2 120170195 missense probably damaging 1.00
R7138:Pla2g4e UTSW 2 120171278 missense probably damaging 1.00
R7300:Pla2g4e UTSW 2 120191199 missense probably damaging 1.00
R7355:Pla2g4e UTSW 2 120181501 missense possibly damaging 0.91
R7502:Pla2g4e UTSW 2 120174338 splice site probably null
R7849:Pla2g4e UTSW 2 120185322 missense probably benign 0.32
R8686:Pla2g4e UTSW 2 120244691 missense probably damaging 0.98
R9003:Pla2g4e UTSW 2 120176801 missense probably benign 0.03
R9023:Pla2g4e UTSW 2 120171237 missense probably benign 0.01
R9261:Pla2g4e UTSW 2 120189429 missense probably benign 0.04
R9284:Pla2g4e UTSW 2 120174249 splice site probably benign
R9299:Pla2g4e UTSW 2 120171723 missense probably damaging 1.00
R9338:Pla2g4e UTSW 2 120189433 missense probably benign 0.07
R9555:Pla2g4e UTSW 2 120244919 start gained probably benign
R9604:Pla2g4e UTSW 2 120185199 missense probably benign 0.02
RF044:Pla2g4e UTSW 2 120244724 small deletion probably benign
Z1177:Pla2g4e UTSW 2 120181523 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTAAAGGAATGCTGGCATCAG -3'
(R):5'- AACAGCTGTTCCTTCTCCATGG -3'

Sequencing Primer
(F):5'- GGTGGAACCTGGACACTTTAC -3'
(R):5'- CATGGCCCTAGGACCAAGTATG -3'
Posted On 2020-07-28