Mutagenetix > Incidental Mutations

Incidental Mutation 'R8288:Pla2g4e'

638516

Institutional Source

Beutler Lab

Gene Symbol

Pla2g4e

Ensembl Gene

ENSMUSG00000050211

Gene Name

phospholipase A2, group IVE

Synonyms

Pla2epsilon, 2310026J01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8288 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

120166412-120245335 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 120188509 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000087525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090071]

Predicted Effect

probably null
Transcript: ENSMUST00000090071

SMART Domains

Protein: ENSMUSP00000087525
Gene: ENSMUSG00000050211

Domain	Start	End	E-Value	Type
low complexity region	61	73	N/A	INTRINSIC
C2	82	182	3.42e-14	SMART
low complexity region	191	207	N/A	INTRINSIC
PLAc	311	818	5.17e-13	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytosolic phospholipase A2 group IV family. Members of this family are involved in regulation of membrane tubule-mediated transport. The enzyme encoded by this member of the family plays a role in trafficking through the clathrin-independent endocytic pathway. The enzyme regulates the recycling process via formation of tubules that transport internalized clathrin-independent cargo proteins back to the cell surface. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap3m2	C	T	8: 22,793,137	A200T	probably benign	Het
Arpp19	T	C	9: 75,037,632	M1T	probably null	Het
Baiap2	T	A	11: 119,997,639	V407E	probably damaging	Het
Cdh18	A	G	15: 23,445,987	T508A	probably damaging	Het
Cnnm3	C	A	1: 36,511,993	A28E	possibly damaging	Het
Cpb1	A	T	3: 20,265,367	C184*	probably null	Het
Ddb1	T	C	19: 10,608,348	V142A	probably benign	Het
Disp2	T	C	2: 118,790,281	V498A	probably damaging	Het
Dmgdh	T	C	13: 93,708,824	Y442H	probably damaging	Het
Eef2k	T	A	7: 120,903,381	M722K	probably damaging	Het
Erbb4	A	G	1: 68,298,350	F603S	probably damaging	Het
Filip1l	C	T	16: 57,570,554	R502C	probably damaging	Het
Gbp9	C	T	5: 105,105,733	V39M	probably damaging	Het
Gm17079	T	C	14: 51,694,358	Y98C		Het
Gstz1	A	G	12: 87,147,830	M1V	probably null	Het
Hsd17b13	T	G	5: 103,963,835	I281L	probably benign	Het
Hydin	A	G	8: 110,507,029	E1833G	probably damaging	Het
Irs1	G	A	1: 82,287,961	Q845*	probably null	Het
Kctd11	C	T	11: 69,880,057	G52R	probably damaging	Het
Kit	T	C	5: 75,654,489	S962P	probably damaging	Het
Lrrn1	C	T	6: 107,566,994		probably benign	Het
Mastl	T	C	2: 23,133,359	K451E	probably damaging	Het
Mptx2	A	G	1: 173,274,789	V111A	probably benign	Het
Nuak2	G	T	1: 132,327,841	C178F	probably damaging	Het
Pah	G	A	10: 87,538,185	R71H	probably benign	Het
Pclo	C	A	5: 14,712,871	T501K		Het
Polq	A	G	16: 37,027,910	E293G	probably damaging	Het
Rptor	G	A	11: 119,857,937	E782K	probably benign	Het
Scn7a	T	A	2: 66,675,974	R1524W	probably damaging	Het
Slc4a5	T	C	6: 83,226,255	S46P	probably benign	Het
Srcap	T	A	7: 127,531,356	I664N	probably damaging	Het
Stk24	A	C	14: 121,293,429	F372V	possibly damaging	Het
Szt2	T	C	4: 118,389,776	S881G	probably damaging	Het
Trim40	T	C	17: 36,883,318	D161G	probably benign	Het
Trip11	T	C	12: 101,894,384	H234R	possibly damaging	Het
Trpc1	T	C	9: 95,721,381	K366R	probably damaging	Het
Ugt2b35	T	C	5: 87,001,457	L189P	probably damaging	Het
Unc80	A	G	1: 66,473,350	S140G	probably benign	Het
Wdr60	A	G	12: 116,213,725	F811S	probably damaging	Het
Zfp446	A	G	7: 12,977,958	E36G	probably benign	Het
Zfp738	T	A	13: 67,670,789	H361L	possibly damaging	Het

Other mutations in Pla2g4e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Pla2g4e	APN	2	120185238	missense	probably benign
IGL01712:Pla2g4e	APN	2	120189403	critical splice donor site	probably null
IGL01859:Pla2g4e	APN	2	120182733	missense	possibly damaging	0.70
IGL02334:Pla2g4e	APN	2	120187236	missense	probably benign
FR4737:Pla2g4e	UTSW	2	120244724	small deletion	probably benign
R0157:Pla2g4e	UTSW	2	120170181	missense	probably benign	0.00
R0578:Pla2g4e	UTSW	2	120244681	splice site	probably benign
R0675:Pla2g4e	UTSW	2	120200198	splice site	probably benign
R1278:Pla2g4e	UTSW	2	120168470	critical splice donor site	probably null
R1346:Pla2g4e	UTSW	2	120182772	missense	probably damaging	1.00
R1760:Pla2g4e	UTSW	2	120170046	missense	possibly damaging	0.50
R1773:Pla2g4e	UTSW	2	120244721	missense	probably benign
R1792:Pla2g4e	UTSW	2	120168474	missense	probably damaging	1.00
R2129:Pla2g4e	UTSW	2	120182811	missense	probably damaging	0.99
R2160:Pla2g4e	UTSW	2	120185206	missense	probably benign	0.00
R2191:Pla2g4e	UTSW	2	120191199	frame shift	probably null
R3901:Pla2g4e	UTSW	2	120168604	missense	probably benign	0.00
R4342:Pla2g4e	UTSW	2	120186446	intron	probably benign
R4414:Pla2g4e	UTSW	2	120182713	missense	probably benign
R4460:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4581:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4599:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4601:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4610:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4611:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4664:Pla2g4e	UTSW	2	120171188	missense	probably damaging	0.97
R4688:Pla2g4e	UTSW	2	120167933	missense	possibly damaging	0.82
R4691:Pla2g4e	UTSW	2	120174300	missense	probably damaging	1.00
R4944:Pla2g4e	UTSW	2	120171237	missense	probably benign	0.01
R5051:Pla2g4e	UTSW	2	120174304	missense	probably damaging	1.00
R5285:Pla2g4e	UTSW	2	120189504	missense	probably damaging	1.00
R5373:Pla2g4e	UTSW	2	120186395	missense	probably benign	0.30
R5374:Pla2g4e	UTSW	2	120186395	missense	probably benign	0.30
R5505:Pla2g4e	UTSW	2	120244775	missense	probably benign	0.08
R5702:Pla2g4e	UTSW	2	120188511	missense	possibly damaging	0.61
R6300:Pla2g4e	UTSW	2	120182738	missense	probably benign	0.00
R6711:Pla2g4e	UTSW	2	120171270	missense	probably benign	0.00
R6920:Pla2g4e	UTSW	2	120185314	missense	possibly damaging	0.82
R6961:Pla2g4e	UTSW	2	120174370	splice site	probably null
R6987:Pla2g4e	UTSW	2	120186380	missense	probably benign	0.01
R7028:Pla2g4e	UTSW	2	120170195	missense	probably damaging	1.00
R7138:Pla2g4e	UTSW	2	120171278	missense	probably damaging	1.00
R7300:Pla2g4e	UTSW	2	120191199	missense	probably damaging	1.00
R7355:Pla2g4e	UTSW	2	120181501	missense	possibly damaging	0.91
R7502:Pla2g4e	UTSW	2	120174338	splice site	probably null
R7849:Pla2g4e	UTSW	2	120185322	missense	probably benign	0.32
R8686:Pla2g4e	UTSW	2	120244691	missense	probably damaging	0.98
RF044:Pla2g4e	UTSW	2	120244724	small deletion	probably benign
Z1177:Pla2g4e	UTSW	2	120181523	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TTTAAAGGAATGCTGGCATCAG -3'
(R):5'- AACAGCTGTTCCTTCTCCATGG -3'

Sequencing Primer
(F):5'- GGTGGAACCTGGACACTTTAC -3'
(R):5'- CATGGCCCTAGGACCAAGTATG -3'

Posted On

2020-07-28