Incidental Mutation 'R8288:Pla2g4e'
ID638516
Institutional Source Beutler Lab
Gene Symbol Pla2g4e
Ensembl Gene ENSMUSG00000050211
Gene Namephospholipase A2, group IVE
SynonymsPla2epsilon, 2310026J01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8288 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location120166412-120245335 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 120188509 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090071]
Predicted Effect probably null
Transcript: ENSMUST00000090071
SMART Domains Protein: ENSMUSP00000087525
Gene: ENSMUSG00000050211

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
C2 82 182 3.42e-14 SMART
low complexity region 191 207 N/A INTRINSIC
PLAc 311 818 5.17e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytosolic phospholipase A2 group IV family. Members of this family are involved in regulation of membrane tubule-mediated transport. The enzyme encoded by this member of the family plays a role in trafficking through the clathrin-independent endocytic pathway. The enzyme regulates the recycling process via formation of tubules that transport internalized clathrin-independent cargo proteins back to the cell surface. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 C T 8: 22,793,137 A200T probably benign Het
Arpp19 T C 9: 75,037,632 M1T probably null Het
Baiap2 T A 11: 119,997,639 V407E probably damaging Het
Cdh18 A G 15: 23,445,987 T508A probably damaging Het
Cnnm3 C A 1: 36,511,993 A28E possibly damaging Het
Cpb1 A T 3: 20,265,367 C184* probably null Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Disp2 T C 2: 118,790,281 V498A probably damaging Het
Dmgdh T C 13: 93,708,824 Y442H probably damaging Het
Eef2k T A 7: 120,903,381 M722K probably damaging Het
Erbb4 A G 1: 68,298,350 F603S probably damaging Het
Filip1l C T 16: 57,570,554 R502C probably damaging Het
Gbp9 C T 5: 105,105,733 V39M probably damaging Het
Gm17079 T C 14: 51,694,358 Y98C Het
Gstz1 A G 12: 87,147,830 M1V probably null Het
Hsd17b13 T G 5: 103,963,835 I281L probably benign Het
Hydin A G 8: 110,507,029 E1833G probably damaging Het
Irs1 G A 1: 82,287,961 Q845* probably null Het
Kctd11 C T 11: 69,880,057 G52R probably damaging Het
Kit T C 5: 75,654,489 S962P probably damaging Het
Lrrn1 C T 6: 107,566,994 probably benign Het
Mastl T C 2: 23,133,359 K451E probably damaging Het
Mptx2 A G 1: 173,274,789 V111A probably benign Het
Nuak2 G T 1: 132,327,841 C178F probably damaging Het
Pah G A 10: 87,538,185 R71H probably benign Het
Pclo C A 5: 14,712,871 T501K Het
Polq A G 16: 37,027,910 E293G probably damaging Het
Rptor G A 11: 119,857,937 E782K probably benign Het
Scn7a T A 2: 66,675,974 R1524W probably damaging Het
Slc4a5 T C 6: 83,226,255 S46P probably benign Het
Srcap T A 7: 127,531,356 I664N probably damaging Het
Stk24 A C 14: 121,293,429 F372V possibly damaging Het
Szt2 T C 4: 118,389,776 S881G probably damaging Het
Trim40 T C 17: 36,883,318 D161G probably benign Het
Trip11 T C 12: 101,894,384 H234R possibly damaging Het
Trpc1 T C 9: 95,721,381 K366R probably damaging Het
Ugt2b35 T C 5: 87,001,457 L189P probably damaging Het
Unc80 A G 1: 66,473,350 S140G probably benign Het
Wdr60 A G 12: 116,213,725 F811S probably damaging Het
Zfp446 A G 7: 12,977,958 E36G probably benign Het
Zfp738 T A 13: 67,670,789 H361L possibly damaging Het
Other mutations in Pla2g4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Pla2g4e APN 2 120185238 missense probably benign
IGL01712:Pla2g4e APN 2 120189403 critical splice donor site probably null
IGL01859:Pla2g4e APN 2 120182733 missense possibly damaging 0.70
IGL02334:Pla2g4e APN 2 120187236 missense probably benign
FR4737:Pla2g4e UTSW 2 120244724 small deletion probably benign
R0157:Pla2g4e UTSW 2 120170181 missense probably benign 0.00
R0578:Pla2g4e UTSW 2 120244681 splice site probably benign
R0675:Pla2g4e UTSW 2 120200198 splice site probably benign
R1278:Pla2g4e UTSW 2 120168470 critical splice donor site probably null
R1346:Pla2g4e UTSW 2 120182772 missense probably damaging 1.00
R1760:Pla2g4e UTSW 2 120170046 missense possibly damaging 0.50
R1773:Pla2g4e UTSW 2 120244721 missense probably benign
R1792:Pla2g4e UTSW 2 120168474 missense probably damaging 1.00
R2129:Pla2g4e UTSW 2 120182811 missense probably damaging 0.99
R2160:Pla2g4e UTSW 2 120185206 missense probably benign 0.00
R2191:Pla2g4e UTSW 2 120191199 frame shift probably null
R3901:Pla2g4e UTSW 2 120168604 missense probably benign 0.00
R4342:Pla2g4e UTSW 2 120186446 intron probably benign
R4414:Pla2g4e UTSW 2 120182713 missense probably benign
R4460:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4581:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4599:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4601:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4610:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4611:Pla2g4e UTSW 2 120186382 missense possibly damaging 0.53
R4664:Pla2g4e UTSW 2 120171188 missense probably damaging 0.97
R4688:Pla2g4e UTSW 2 120167933 missense possibly damaging 0.82
R4691:Pla2g4e UTSW 2 120174300 missense probably damaging 1.00
R4944:Pla2g4e UTSW 2 120171237 missense probably benign 0.01
R5051:Pla2g4e UTSW 2 120174304 missense probably damaging 1.00
R5285:Pla2g4e UTSW 2 120189504 missense probably damaging 1.00
R5373:Pla2g4e UTSW 2 120186395 missense probably benign 0.30
R5374:Pla2g4e UTSW 2 120186395 missense probably benign 0.30
R5505:Pla2g4e UTSW 2 120244775 missense probably benign 0.08
R5702:Pla2g4e UTSW 2 120188511 missense possibly damaging 0.61
R6300:Pla2g4e UTSW 2 120182738 missense probably benign 0.00
R6711:Pla2g4e UTSW 2 120171270 missense probably benign 0.00
R6920:Pla2g4e UTSW 2 120185314 missense possibly damaging 0.82
R6961:Pla2g4e UTSW 2 120174370 splice site probably null
R6987:Pla2g4e UTSW 2 120186380 missense probably benign 0.01
R7028:Pla2g4e UTSW 2 120170195 missense probably damaging 1.00
R7138:Pla2g4e UTSW 2 120171278 missense probably damaging 1.00
R7300:Pla2g4e UTSW 2 120191199 missense probably damaging 1.00
R7355:Pla2g4e UTSW 2 120181501 missense possibly damaging 0.91
R7502:Pla2g4e UTSW 2 120174338 splice site probably null
R7849:Pla2g4e UTSW 2 120185322 missense probably benign 0.32
R8686:Pla2g4e UTSW 2 120244691 missense probably damaging 0.98
RF044:Pla2g4e UTSW 2 120244724 small deletion probably benign
Z1177:Pla2g4e UTSW 2 120181523 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTAAAGGAATGCTGGCATCAG -3'
(R):5'- AACAGCTGTTCCTTCTCCATGG -3'

Sequencing Primer
(F):5'- GGTGGAACCTGGACACTTTAC -3'
(R):5'- CATGGCCCTAGGACCAAGTATG -3'
Posted On2020-07-28