Incidental Mutation 'R8288:Gbp9'
ID638523
Institutional Source Beutler Lab
Gene Symbol Gbp9
Ensembl Gene ENSMUSG00000029298
Gene Nameguanylate-binding protein 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R8288 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location105077630-105139539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105105733 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 39 (V39M)
Ref Sequence ENSEMBL: ENSMUSP00000031238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031235] [ENSMUST00000031238] [ENSMUST00000100961]
Predicted Effect probably benign
Transcript: ENSMUST00000031235
SMART Domains Protein: ENSMUSP00000031235
Gene: ENSMUSG00000034438

DomainStartEndE-ValueType
Pfam:GBP 16 213 5.4e-91 PFAM
Pfam:GBP_C 206 493 1e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000031238
AA Change: V39M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031238
Gene: ENSMUSG00000029298
AA Change: V39M

DomainStartEndE-ValueType
Pfam:GBP 16 279 1.2e-117 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100961
AA Change: V39M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098521
Gene: ENSMUSG00000029298
AA Change: V39M

DomainStartEndE-ValueType
Pfam:GBP 16 279 3.8e-124 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 C T 8: 22,793,137 A200T probably benign Het
Arpp19 T C 9: 75,037,632 M1T probably null Het
Baiap2 T A 11: 119,997,639 V407E probably damaging Het
Cdh18 A G 15: 23,445,987 T508A probably damaging Het
Cnnm3 C A 1: 36,511,993 A28E possibly damaging Het
Cpb1 A T 3: 20,265,367 C184* probably null Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Disp2 T C 2: 118,790,281 V498A probably damaging Het
Dmgdh T C 13: 93,708,824 Y442H probably damaging Het
Eef2k T A 7: 120,903,381 M722K probably damaging Het
Erbb4 A G 1: 68,298,350 F603S probably damaging Het
Filip1l C T 16: 57,570,554 R502C probably damaging Het
Gm17079 T C 14: 51,694,358 Y98C Het
Gstz1 A G 12: 87,147,830 M1V probably null Het
Hsd17b13 T G 5: 103,963,835 I281L probably benign Het
Hydin A G 8: 110,507,029 E1833G probably damaging Het
Irs1 G A 1: 82,287,961 Q845* probably null Het
Kctd11 C T 11: 69,880,057 G52R probably damaging Het
Kit T C 5: 75,654,489 S962P probably damaging Het
Lrrn1 C T 6: 107,566,994 probably benign Het
Mastl T C 2: 23,133,359 K451E probably damaging Het
Mptx2 A G 1: 173,274,789 V111A probably benign Het
Nuak2 G T 1: 132,327,841 C178F probably damaging Het
Pah G A 10: 87,538,185 R71H probably benign Het
Pclo C A 5: 14,712,871 T501K Het
Pla2g4e C T 2: 120,188,509 probably null Het
Polq A G 16: 37,027,910 E293G probably damaging Het
Rptor G A 11: 119,857,937 E782K probably benign Het
Scn7a T A 2: 66,675,974 R1524W probably damaging Het
Slc4a5 T C 6: 83,226,255 S46P probably benign Het
Srcap T A 7: 127,531,356 I664N probably damaging Het
Stk24 A C 14: 121,293,429 F372V possibly damaging Het
Szt2 T C 4: 118,389,776 S881G probably damaging Het
Trim40 T C 17: 36,883,318 D161G probably benign Het
Trip11 T C 12: 101,894,384 H234R possibly damaging Het
Trpc1 T C 9: 95,721,381 K366R probably damaging Het
Ugt2b35 T C 5: 87,001,457 L189P probably damaging Het
Unc80 A G 1: 66,473,350 S140G probably benign Het
Wdr60 A G 12: 116,213,725 F811S probably damaging Het
Zfp446 A G 7: 12,977,958 E36G probably benign Het
Zfp738 T A 13: 67,670,789 H361L possibly damaging Het
Other mutations in Gbp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Gbp9 APN 5 105081264 missense probably benign 0.01
IGL00419:Gbp9 APN 5 105094077 missense probably benign 0.05
IGL00425:Gbp9 APN 5 105105754 missense possibly damaging 0.82
IGL00597:Gbp9 APN 5 105094498 missense probably damaging 1.00
IGL01362:Gbp9 APN 5 105080206 missense probably damaging 1.00
IGL01679:Gbp9 APN 5 105085172 splice site probably null
IGL01803:Gbp9 APN 5 105094173 missense probably damaging 1.00
IGL01803:Gbp9 APN 5 105085018 missense probably damaging 0.99
IGL02054:Gbp9 APN 5 105082807 missense probably benign 0.12
IGL02474:Gbp9 APN 5 105094567 splice site probably benign
IGL02633:Gbp9 APN 5 105083565 splice site probably benign
IGL02666:Gbp9 APN 5 105094275 splice site probably null
IGL02689:Gbp9 APN 5 105105796 missense probably benign 0.11
IGL02812:Gbp9 APN 5 105083758 missense probably damaging 1.00
IGL03132:Gbp9 APN 5 105084953 missense possibly damaging 0.83
IGL03274:Gbp9 APN 5 105082786 missense possibly damaging 0.58
R0410:Gbp9 UTSW 5 105085073 missense probably benign 0.17
R1018:Gbp9 UTSW 5 105080260 missense probably benign 0.15
R1479:Gbp9 UTSW 5 105094064 splice site probably benign
R1655:Gbp9 UTSW 5 105081692 missense possibly damaging 0.76
R1658:Gbp9 UTSW 5 105094468 missense probably damaging 0.98
R1757:Gbp9 UTSW 5 105094453 missense probably damaging 1.00
R1950:Gbp9 UTSW 5 105081246 missense probably benign 0.01
R1986:Gbp9 UTSW 5 105105724 missense probably damaging 1.00
R1986:Gbp9 UTSW 5 105105786 missense probably damaging 0.98
R2124:Gbp9 UTSW 5 105094543 missense probably damaging 1.00
R2302:Gbp9 UTSW 5 105094092 missense possibly damaging 0.47
R2378:Gbp9 UTSW 5 105080176 missense probably benign 0.02
R2997:Gbp9 UTSW 5 105082769 missense probably benign 0.00
R3745:Gbp9 UTSW 5 105105858 start gained probably benign
R4182:Gbp9 UTSW 5 105083595 missense probably benign 0.08
R4485:Gbp9 UTSW 5 105083808 missense probably damaging 0.97
R4718:Gbp9 UTSW 5 105083758 missense probably damaging 1.00
R5063:Gbp9 UTSW 5 105085162 missense probably benign
R5099:Gbp9 UTSW 5 105094513 missense probably damaging 1.00
R5104:Gbp9 UTSW 5 105080141 missense probably benign 0.00
R5199:Gbp9 UTSW 5 105083812 missense probably benign 0.04
R5712:Gbp9 UTSW 5 105094555 missense possibly damaging 0.80
R5751:Gbp9 UTSW 5 105081258 missense probably benign 0.06
R5895:Gbp9 UTSW 5 105082858 missense probably damaging 1.00
R6360:Gbp9 UTSW 5 105083730 missense probably benign 0.03
R6646:Gbp9 UTSW 5 105082903 missense probably benign 0.13
R7559:Gbp9 UTSW 5 105085109 missense probably damaging 1.00
R7819:Gbp9 UTSW 5 105103879 missense possibly damaging 0.65
R8042:Gbp9 UTSW 5 105094242 missense probably damaging 1.00
R8303:Gbp9 UTSW 5 105081305 missense possibly damaging 0.94
R8354:Gbp9 UTSW 5 105094161 missense probably damaging 0.97
R8395:Gbp9 UTSW 5 105080203 missense probably damaging 1.00
R8397:Gbp9 UTSW 5 105083598 missense possibly damaging 0.94
R8751:Gbp9 UTSW 5 105081251 missense possibly damaging 0.49
R8808:Gbp9 UTSW 5 105085009 missense probably damaging 1.00
Z1088:Gbp9 UTSW 5 105094125 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTAGCATGAGAGGGTGGC -3'
(R):5'- ACTGGTCTTAGCTGCTGAGC -3'

Sequencing Primer
(F):5'- GCTTTGCTAAAAAGGAGTTCTGC -3'
(R):5'- GCTGCTGAGCCATTGGG -3'
Posted On2020-07-28