Incidental Mutation 'R8288:Slc4a5'
ID 638524
Institutional Source Beutler Lab
Gene Symbol Slc4a5
Ensembl Gene ENSMUSG00000068323
Gene Name solute carrier family 4, sodium bicarbonate cotransporter, member 5
Synonyms C330016K18Rik
MMRRC Submission 067710-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.185) question?
Stock # R8288 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 83196810-83281927 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83203237 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 46 (S46P)
Ref Sequence ENSEMBL: ENSMUSP00000109533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113900]
AlphaFold E9Q3M5
Predicted Effect probably benign
Transcript: ENSMUST00000113900
AA Change: S46P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000109533
Gene: ENSMUSG00000068323
AA Change: S46P

DomainStartEndE-ValueType
Pfam:Band_3_cyto 140 407 3.4e-106 PFAM
low complexity region 436 465 N/A INTRINSIC
Pfam:HCO3_cotransp 480 999 1.6e-224 PFAM
transmembrane domain 1006 1028 N/A INTRINSIC
low complexity region 1051 1066 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium bicarbonate cotransporter (NBC) family, part of the bicarbonate transporter superfamily. Sodium bicarbonate cotransporters are involved in intracellular pH regulation and electroneural or electrogenic sodium bicarbonate transport. This protein is thought to be an integral membrane protein. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit arterial hypertension and renal metabolic acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 C T 8: 23,283,153 (GRCm39) A200T probably benign Het
Arpp19 T C 9: 74,944,914 (GRCm39) M1T probably null Het
Baiap2 T A 11: 119,888,465 (GRCm39) V407E probably damaging Het
Cdh18 A G 15: 23,446,073 (GRCm39) T508A probably damaging Het
Cnnm3 C A 1: 36,551,074 (GRCm39) A28E possibly damaging Het
Cpb1 A T 3: 20,319,531 (GRCm39) C184* probably null Het
Ddb1 T C 19: 10,585,712 (GRCm39) V142A probably benign Het
Disp2 T C 2: 118,620,762 (GRCm39) V498A probably damaging Het
Dmgdh T C 13: 93,845,332 (GRCm39) Y442H probably damaging Het
Dync2i1 A G 12: 116,177,345 (GRCm39) F811S probably damaging Het
Eef2k T A 7: 120,502,604 (GRCm39) M722K probably damaging Het
Erbb4 A G 1: 68,337,509 (GRCm39) F603S probably damaging Het
Filip1l C T 16: 57,390,917 (GRCm39) R502C probably damaging Het
Gbp9 C T 5: 105,253,599 (GRCm39) V39M probably damaging Het
Gm17079 T C 14: 51,931,815 (GRCm39) Y98C Het
Gstz1 A G 12: 87,194,604 (GRCm39) M1V probably null Het
Hsd17b13 T G 5: 104,111,701 (GRCm39) I281L probably benign Het
Hydin A G 8: 111,233,661 (GRCm39) E1833G probably damaging Het
Irs1 G A 1: 82,265,682 (GRCm39) Q845* probably null Het
Kctd11 C T 11: 69,770,883 (GRCm39) G52R probably damaging Het
Kit T C 5: 75,815,149 (GRCm39) S962P probably damaging Het
Lrrn1 C T 6: 107,543,955 (GRCm39) probably benign Het
Mastl T C 2: 23,023,371 (GRCm39) K451E probably damaging Het
Mptx2 A G 1: 173,102,356 (GRCm39) V111A probably benign Het
Nuak2 G T 1: 132,255,579 (GRCm39) C178F probably damaging Het
Pah G A 10: 87,374,047 (GRCm39) R71H probably benign Het
Pclo C A 5: 14,762,885 (GRCm39) T501K Het
Pla2g4e C T 2: 120,018,990 (GRCm39) probably null Het
Polq A G 16: 36,848,272 (GRCm39) E293G probably damaging Het
Rptor G A 11: 119,748,763 (GRCm39) E782K probably benign Het
Scn7a T A 2: 66,506,318 (GRCm39) R1524W probably damaging Het
Srcap T A 7: 127,130,528 (GRCm39) I664N probably damaging Het
Stk24 A C 14: 121,530,841 (GRCm39) F372V possibly damaging Het
Szt2 T C 4: 118,246,973 (GRCm39) S881G probably damaging Het
Trim40 T C 17: 37,194,210 (GRCm39) D161G probably benign Het
Trip11 T C 12: 101,860,643 (GRCm39) H234R possibly damaging Het
Trpc1 T C 9: 95,603,434 (GRCm39) K366R probably damaging Het
Ugt2b35 T C 5: 87,149,316 (GRCm39) L189P probably damaging Het
Unc80 A G 1: 66,512,509 (GRCm39) S140G probably benign Het
Zfp446 A G 7: 12,711,885 (GRCm39) E36G probably benign Het
Zfp738 T A 13: 67,818,908 (GRCm39) H361L possibly damaging Het
Other mutations in Slc4a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Slc4a5 APN 6 83,262,881 (GRCm39) missense probably damaging 1.00
IGL00473:Slc4a5 APN 6 83,273,579 (GRCm39) missense probably damaging 1.00
IGL00861:Slc4a5 APN 6 83,276,453 (GRCm39) missense probably benign
IGL01025:Slc4a5 APN 6 83,239,515 (GRCm39) missense probably damaging 0.98
IGL01532:Slc4a5 APN 6 83,250,022 (GRCm39) splice site probably null
IGL01991:Slc4a5 APN 6 83,240,525 (GRCm39) missense possibly damaging 0.94
IGL02271:Slc4a5 APN 6 83,248,085 (GRCm39) splice site probably benign
IGL02565:Slc4a5 APN 6 83,276,487 (GRCm39) missense probably benign 0.00
IGL02669:Slc4a5 APN 6 83,240,525 (GRCm39) missense possibly damaging 0.79
IGL02994:Slc4a5 APN 6 83,249,106 (GRCm39) missense probably damaging 1.00
IGL03259:Slc4a5 APN 6 83,247,979 (GRCm39) missense probably damaging 1.00
IGL03264:Slc4a5 APN 6 83,238,507 (GRCm39) missense probably damaging 1.00
R0032:Slc4a5 UTSW 6 83,250,139 (GRCm39) missense probably damaging 1.00
R0091:Slc4a5 UTSW 6 83,254,537 (GRCm39) missense probably benign 0.00
R0281:Slc4a5 UTSW 6 83,244,549 (GRCm39) splice site probably benign
R0366:Slc4a5 UTSW 6 83,272,854 (GRCm39) missense probably benign 0.02
R0668:Slc4a5 UTSW 6 83,248,054 (GRCm39) missense probably damaging 1.00
R1222:Slc4a5 UTSW 6 83,257,114 (GRCm39) missense probably damaging 1.00
R1550:Slc4a5 UTSW 6 83,248,039 (GRCm39) missense probably damaging 1.00
R1585:Slc4a5 UTSW 6 83,242,669 (GRCm39) missense probably damaging 1.00
R1731:Slc4a5 UTSW 6 83,273,617 (GRCm39) missense probably damaging 1.00
R1987:Slc4a5 UTSW 6 83,250,214 (GRCm39) missense possibly damaging 0.95
R2103:Slc4a5 UTSW 6 83,274,360 (GRCm39) missense probably benign 0.00
R2103:Slc4a5 UTSW 6 83,201,663 (GRCm39) missense probably benign 0.00
R2104:Slc4a5 UTSW 6 83,274,360 (GRCm39) missense probably benign 0.00
R2176:Slc4a5 UTSW 6 83,239,542 (GRCm39) missense probably damaging 0.98
R2920:Slc4a5 UTSW 6 83,241,369 (GRCm39) missense probably damaging 1.00
R2964:Slc4a5 UTSW 6 83,273,651 (GRCm39) missense probably damaging 1.00
R2965:Slc4a5 UTSW 6 83,273,651 (GRCm39) missense probably damaging 1.00
R2966:Slc4a5 UTSW 6 83,273,651 (GRCm39) missense probably damaging 1.00
R3755:Slc4a5 UTSW 6 83,265,285 (GRCm39) missense probably benign 0.26
R3756:Slc4a5 UTSW 6 83,265,285 (GRCm39) missense probably benign 0.26
R4293:Slc4a5 UTSW 6 83,237,511 (GRCm39) missense probably damaging 1.00
R4789:Slc4a5 UTSW 6 83,247,951 (GRCm39) missense probably benign 0.05
R4823:Slc4a5 UTSW 6 83,249,115 (GRCm39) missense probably damaging 1.00
R4854:Slc4a5 UTSW 6 83,247,999 (GRCm39) missense probably benign 0.00
R5461:Slc4a5 UTSW 6 83,262,836 (GRCm39) missense probably benign 0.29
R5707:Slc4a5 UTSW 6 83,238,397 (GRCm39) missense probably benign 0.11
R5747:Slc4a5 UTSW 6 83,248,011 (GRCm39) missense probably damaging 1.00
R5978:Slc4a5 UTSW 6 83,254,518 (GRCm39) missense probably benign 0.01
R6126:Slc4a5 UTSW 6 83,203,247 (GRCm39) missense probably benign 0.05
R6330:Slc4a5 UTSW 6 83,203,356 (GRCm39) missense probably benign
R6564:Slc4a5 UTSW 6 83,257,042 (GRCm39) missense possibly damaging 0.71
R6786:Slc4a5 UTSW 6 83,273,729 (GRCm39) critical splice donor site probably null
R7443:Slc4a5 UTSW 6 83,241,297 (GRCm39) missense probably benign 0.45
R7672:Slc4a5 UTSW 6 83,237,517 (GRCm39) missense probably damaging 1.00
R7690:Slc4a5 UTSW 6 83,262,854 (GRCm39) missense probably damaging 1.00
R7837:Slc4a5 UTSW 6 83,238,539 (GRCm39) missense probably benign 0.01
R8169:Slc4a5 UTSW 6 83,280,373 (GRCm39) missense probably benign 0.12
R8397:Slc4a5 UTSW 6 83,266,308 (GRCm39) critical splice donor site probably null
R8849:Slc4a5 UTSW 6 83,250,180 (GRCm39) missense probably damaging 1.00
R9033:Slc4a5 UTSW 6 83,237,457 (GRCm39) nonsense probably null
R9133:Slc4a5 UTSW 6 83,203,217 (GRCm39) missense possibly damaging 0.85
R9201:Slc4a5 UTSW 6 83,262,812 (GRCm39) missense probably benign 0.02
R9269:Slc4a5 UTSW 6 83,266,223 (GRCm39) missense possibly damaging 0.88
R9603:Slc4a5 UTSW 6 83,217,714 (GRCm39) missense probably benign 0.34
R9781:Slc4a5 UTSW 6 83,239,466 (GRCm39) missense probably benign 0.00
Z1177:Slc4a5 UTSW 6 83,257,015 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTTGTATTCTGACAGAACC -3'
(R):5'- CTGTACCCACCAACAGGTTG -3'

Sequencing Primer
(F):5'- GTATTCTGACAGAACCTTCATCCCAG -3'
(R):5'- TGGCTCTTGAAGGAACATGCC -3'
Posted On 2020-07-28