Incidental Mutation 'R8288:Zfp446'
ID638526
Institutional Source Beutler Lab
Gene Symbol Zfp446
Ensembl Gene ENSMUSG00000033961
Gene Namezinc finger protein 446
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R8288 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12977848-12985714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12977958 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 36 (E36G)
Ref Sequence ENSEMBL: ENSMUSP00000039073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038701] [ENSMUST00000045810] [ENSMUST00000108535] [ENSMUST00000108536] [ENSMUST00000108537] [ENSMUST00000124387] [ENSMUST00000128293]
Predicted Effect probably benign
Transcript: ENSMUST00000038701
SMART Domains Protein: ENSMUSP00000041944
Gene: ENSMUSG00000004500

DomainStartEndE-ValueType
KRAB 31 91 8.89e-30 SMART
ZnF_C2H2 291 313 2.95e-3 SMART
ZnF_C2H2 319 341 1.82e-3 SMART
ZnF_C2H2 347 369 6.88e-4 SMART
ZnF_C2H2 375 397 1.95e-3 SMART
ZnF_C2H2 403 425 2.71e-2 SMART
ZnF_C2H2 431 453 2.95e-3 SMART
ZnF_C2H2 459 481 2.75e-3 SMART
ZnF_C2H2 487 509 1.25e-1 SMART
ZnF_C2H2 515 537 7.37e-4 SMART
low complexity region 564 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045810
AA Change: E36G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000039073
Gene: ENSMUSG00000033961
AA Change: E36G

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
SCAN 122 234 1.29e-53 SMART
KRAB 299 360 3.96e-2 SMART
ZnF_C2H2 419 441 2.95e-3 SMART
ZnF_C2H2 468 490 8.47e-4 SMART
ZnF_C2H2 496 518 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108535
SMART Domains Protein: ENSMUSP00000104175
Gene: ENSMUSG00000033961

DomainStartEndE-ValueType
SCAN 22 134 1.29e-53 SMART
KRAB 199 254 1.14e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108536
SMART Domains Protein: ENSMUSP00000104176
Gene: ENSMUSG00000033961

DomainStartEndE-ValueType
SCAN 22 134 1.29e-53 SMART
KRAB 199 260 3.96e-2 SMART
ZnF_C2H2 319 341 2.95e-3 SMART
ZnF_C2H2 368 390 8.47e-4 SMART
ZnF_C2H2 396 418 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108537
SMART Domains Protein: ENSMUSP00000104177
Gene: ENSMUSG00000033961

DomainStartEndE-ValueType
SCAN 22 128 7.37e-49 SMART
KRAB 124 185 3.96e-2 SMART
ZnF_C2H2 244 266 2.95e-3 SMART
ZnF_C2H2 293 315 8.47e-4 SMART
ZnF_C2H2 321 343 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124387
Predicted Effect probably benign
Transcript: ENSMUST00000128293
SMART Domains Protein: ENSMUSP00000124620
Gene: ENSMUSG00000004500

DomainStartEndE-ValueType
KRAB 31 75 3.83e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 C T 8: 22,793,137 A200T probably benign Het
Arpp19 T C 9: 75,037,632 M1T probably null Het
Baiap2 T A 11: 119,997,639 V407E probably damaging Het
Cdh18 A G 15: 23,445,987 T508A probably damaging Het
Cnnm3 C A 1: 36,511,993 A28E possibly damaging Het
Cpb1 A T 3: 20,265,367 C184* probably null Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Disp2 T C 2: 118,790,281 V498A probably damaging Het
Dmgdh T C 13: 93,708,824 Y442H probably damaging Het
Eef2k T A 7: 120,903,381 M722K probably damaging Het
Erbb4 A G 1: 68,298,350 F603S probably damaging Het
Filip1l C T 16: 57,570,554 R502C probably damaging Het
Gbp9 C T 5: 105,105,733 V39M probably damaging Het
Gm17079 T C 14: 51,694,358 Y98C Het
Gstz1 A G 12: 87,147,830 M1V probably null Het
Hsd17b13 T G 5: 103,963,835 I281L probably benign Het
Hydin A G 8: 110,507,029 E1833G probably damaging Het
Irs1 G A 1: 82,287,961 Q845* probably null Het
Kctd11 C T 11: 69,880,057 G52R probably damaging Het
Kit T C 5: 75,654,489 S962P probably damaging Het
Lrrn1 C T 6: 107,566,994 probably benign Het
Mastl T C 2: 23,133,359 K451E probably damaging Het
Mptx2 A G 1: 173,274,789 V111A probably benign Het
Nuak2 G T 1: 132,327,841 C178F probably damaging Het
Pah G A 10: 87,538,185 R71H probably benign Het
Pclo C A 5: 14,712,871 T501K Het
Pla2g4e C T 2: 120,188,509 probably null Het
Polq A G 16: 37,027,910 E293G probably damaging Het
Rptor G A 11: 119,857,937 E782K probably benign Het
Scn7a T A 2: 66,675,974 R1524W probably damaging Het
Slc4a5 T C 6: 83,226,255 S46P probably benign Het
Srcap T A 7: 127,531,356 I664N probably damaging Het
Stk24 A C 14: 121,293,429 F372V possibly damaging Het
Szt2 T C 4: 118,389,776 S881G probably damaging Het
Trim40 T C 17: 36,883,318 D161G probably benign Het
Trip11 T C 12: 101,894,384 H234R possibly damaging Het
Trpc1 T C 9: 95,721,381 K366R probably damaging Het
Ugt2b35 T C 5: 87,001,457 L189P probably damaging Het
Unc80 A G 1: 66,473,350 S140G probably benign Het
Wdr60 A G 12: 116,213,725 F811S probably damaging Het
Zfp738 T A 13: 67,670,789 H361L possibly damaging Het
Other mutations in Zfp446
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Zfp446 APN 7 12979380 critical splice donor site probably null
IGL01534:Zfp446 APN 7 12979566 missense probably damaging 1.00
IGL02471:Zfp446 APN 7 12982254 missense probably benign 0.41
IGL02888:Zfp446 APN 7 12979328 missense probably damaging 1.00
IGL03153:Zfp446 APN 7 12977907 missense probably benign 0.01
IGL03185:Zfp446 APN 7 12978998 missense probably null 0.43
IGL03242:Zfp446 APN 7 12979325 missense probably damaging 1.00
R0538:Zfp446 UTSW 7 12979589 missense possibly damaging 0.94
R1809:Zfp446 UTSW 7 12979121 missense probably damaging 1.00
R3686:Zfp446 UTSW 7 12982653 missense probably damaging 0.97
R3701:Zfp446 UTSW 7 12978152 unclassified probably benign
R5256:Zfp446 UTSW 7 12979304 nonsense probably null
R5363:Zfp446 UTSW 7 12978057 missense probably benign 0.20
R5377:Zfp446 UTSW 7 12982251 missense possibly damaging 0.88
R6806:Zfp446 UTSW 7 12979116 missense probably damaging 1.00
R7167:Zfp446 UTSW 7 12978122 unclassified probably benign
R7988:Zfp446 UTSW 7 12979043 missense possibly damaging 0.93
R8487:Zfp446 UTSW 7 12982628 missense possibly damaging 0.68
R8943:Zfp446 UTSW 7 12979637 nonsense probably null
Z1177:Zfp446 UTSW 7 12978166 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCTGTTACCTAGGAGACACAAG -3'
(R):5'- TTCCAGGAAGTGACACCGAG -3'

Sequencing Primer
(F):5'- CACAAGGAGCGAGAGTCCTTC -3'
(R):5'- GAAGTGACACCGAGCACGTC -3'
Posted On2020-07-28