Mutagenetix > Incidental Mutations

Incidental Mutation 'R8288:Eef2k'

638527

Institutional Source

Beutler Lab

Gene Symbol

Eef2k

Ensembl Gene

ENSMUSG00000035064

Gene Name

eukaryotic elongation factor-2 kinase

Synonyms

eEF-2K

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.113) question?

Stock #

R8288 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

120842831-120907450 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 120903381 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 722 (M722K)

Ref Sequence

ENSEMBL: ENSMUSP00000046595 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047875] [ENSMUST00000106487] [ENSMUST00000106488] [ENSMUST00000106489] [ENSMUST00000146482]

Predicted Effect

probably damaging
Transcript: ENSMUST00000047875
AA Change: M722K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000046595
Gene: ENSMUSG00000035064
AA Change: M722K

Domain	Start	End	E-Value	Type
Blast:Alpha_kinase	5	81	2e-12	BLAST
Alpha_kinase	120	317	7.75e-109	SMART
low complexity region	358	376	N/A	INTRINSIC
Pfam:Sel1	525	562	7.2e-5	PFAM
Pfam:Sel1	564	608	2.9e-3	PFAM
Pfam:Sel1	609	645	1.3e-1	PFAM
Pfam:Sel1	665	699	1.2e-2	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106487

SMART Domains

Protein: ENSMUSP00000102096
Gene: ENSMUSG00000035064

Domain	Start	End	E-Value	Type
Blast:Alpha_kinase	5	81	1e-12	BLAST
Alpha_kinase	120	317	7.75e-109	SMART
Pfam:Sel1	432	472	1.8e-3	PFAM
Pfam:Sel1	474	518	7.2e-3	PFAM
Pfam:Sel1	519	555	8e-2	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000106488
AA Change: M722K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102097
Gene: ENSMUSG00000035064
AA Change: M722K

Domain	Start	End	E-Value	Type
Blast:Alpha_kinase	5	81	2e-12	BLAST
Alpha_kinase	120	317	7.75e-109	SMART
low complexity region	358	376	N/A	INTRINSIC
Pfam:Sel1	522	562	1.1e-3	PFAM
Pfam:Sel1	564	608	3.9e-3	PFAM
Pfam:Sel1	609	645	4.8e-2	PFAM
Pfam:Sel1	664	699	4.6e-3	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000106489
AA Change: M722K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102098
Gene: ENSMUSG00000035064
AA Change: M722K

Domain	Start	End	E-Value	Type
Blast:Alpha_kinase	5	81	2e-12	BLAST
Alpha_kinase	120	317	7.75e-109	SMART
low complexity region	358	376	N/A	INTRINSIC
Pfam:Sel1	522	562	1.1e-3	PFAM
Pfam:Sel1	564	608	3.9e-3	PFAM
Pfam:Sel1	609	645	4.8e-2	PFAM
Pfam:Sel1	664	699	4.6e-3	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000146482
AA Change: M183K

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein kinase in the calmodulin-mediated signaling pathway that links activation of cell surface receptors to cell division. This kinase is involved in the regulation of protein synthesis. It phosphorylates eukaryotic elongation factor 2 (EEF2) and thus inhibits the EEF2 function. The activity of this kinase is increased in many cancers and may be a valid target for anti-cancer treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired regulation of ovarian follicular degeneration and apoptosis, prolonged estrus, and increased ovarian follicle numbers in aged females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap3m2	C	T	8: 22,793,137	A200T	probably benign	Het
Arpp19	T	C	9: 75,037,632	M1T	probably null	Het
Baiap2	T	A	11: 119,997,639	V407E	probably damaging	Het
Cdh18	A	G	15: 23,445,987	T508A	probably damaging	Het
Cnnm3	C	A	1: 36,511,993	A28E	possibly damaging	Het
Cpb1	A	T	3: 20,265,367	C184*	probably null	Het
Ddb1	T	C	19: 10,608,348	V142A	probably benign	Het
Disp2	T	C	2: 118,790,281	V498A	probably damaging	Het
Dmgdh	T	C	13: 93,708,824	Y442H	probably damaging	Het
Erbb4	A	G	1: 68,298,350	F603S	probably damaging	Het
Filip1l	C	T	16: 57,570,554	R502C	probably damaging	Het
Gbp9	C	T	5: 105,105,733	V39M	probably damaging	Het
Gm17079	T	C	14: 51,694,358	Y98C		Het
Gstz1	A	G	12: 87,147,830	M1V	probably null	Het
Hsd17b13	T	G	5: 103,963,835	I281L	probably benign	Het
Hydin	A	G	8: 110,507,029	E1833G	probably damaging	Het
Irs1	G	A	1: 82,287,961	Q845*	probably null	Het
Kctd11	C	T	11: 69,880,057	G52R	probably damaging	Het
Kit	T	C	5: 75,654,489	S962P	probably damaging	Het
Lrrn1	C	T	6: 107,566,994		probably benign	Het
Mastl	T	C	2: 23,133,359	K451E	probably damaging	Het
Mptx2	A	G	1: 173,274,789	V111A	probably benign	Het
Nuak2	G	T	1: 132,327,841	C178F	probably damaging	Het
Pah	G	A	10: 87,538,185	R71H	probably benign	Het
Pclo	C	A	5: 14,712,871	T501K		Het
Pla2g4e	C	T	2: 120,188,509		probably null	Het
Polq	A	G	16: 37,027,910	E293G	probably damaging	Het
Rptor	G	A	11: 119,857,937	E782K	probably benign	Het
Scn7a	T	A	2: 66,675,974	R1524W	probably damaging	Het
Slc4a5	T	C	6: 83,226,255	S46P	probably benign	Het
Srcap	T	A	7: 127,531,356	I664N	probably damaging	Het
Stk24	A	C	14: 121,293,429	F372V	possibly damaging	Het
Szt2	T	C	4: 118,389,776	S881G	probably damaging	Het
Trim40	T	C	17: 36,883,318	D161G	probably benign	Het
Trip11	T	C	12: 101,894,384	H234R	possibly damaging	Het
Trpc1	T	C	9: 95,721,381	K366R	probably damaging	Het
Ugt2b35	T	C	5: 87,001,457	L189P	probably damaging	Het
Unc80	A	G	1: 66,473,350	S140G	probably benign	Het
Wdr60	A	G	12: 116,213,725	F811S	probably damaging	Het
Zfp446	A	G	7: 12,977,958	E36G	probably benign	Het
Zfp738	T	A	13: 67,670,789	H361L	possibly damaging	Het

Other mutations in Eef2k

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01323:Eef2k	APN	7	120884815	unclassified	probably benign
IGL01481:Eef2k	APN	7	120895218	missense	probably benign	0.23
IGL01935:Eef2k	APN	7	120885831	missense	probably damaging	1.00
IGL03109:Eef2k	APN	7	120891726	missense	probably damaging	1.00
R0458:Eef2k	UTSW	7	120903290	missense	probably damaging	0.99
R1639:Eef2k	UTSW	7	120885828	missense	probably damaging	1.00
R1986:Eef2k	UTSW	7	120873346	missense	possibly damaging	0.92
R3419:Eef2k	UTSW	7	120885870	missense	probably damaging	0.99
R3610:Eef2k	UTSW	7	120889235	missense	probably benign
R3707:Eef2k	UTSW	7	120884712	missense	probably damaging	1.00
R3856:Eef2k	UTSW	7	120899371	nonsense	probably null
R4024:Eef2k	UTSW	7	120858598	missense	probably benign	0.01
R4535:Eef2k	UTSW	7	120858599	nonsense	probably null
R4885:Eef2k	UTSW	7	120891932	missense	probably benign
R5137:Eef2k	UTSW	7	120885422	missense	probably damaging	0.99
R5137:Eef2k	UTSW	7	120885423	missense	probably damaging	1.00
R5501:Eef2k	UTSW	7	120889248	missense	probably benign	0.00
R5610:Eef2k	UTSW	7	120886782	missense	probably benign	0.00
R5633:Eef2k	UTSW	7	120873290	intron	probably benign
R7002:Eef2k	UTSW	7	120891932	missense	probably benign
R7166:Eef2k	UTSW	7	120884772	missense	probably damaging	1.00
R7254:Eef2k	UTSW	7	120889265	missense	probably benign	0.11
R7466:Eef2k	UTSW	7	120903484	splice site	probably null
R7486:Eef2k	UTSW	7	120858570	missense	probably benign
R7538:Eef2k	UTSW	7	120891992	missense	probably benign	0.29
R7593:Eef2k	UTSW	7	120889268	critical splice donor site	probably null
R7675:Eef2k	UTSW	7	120858504	missense	probably benign
R7815:Eef2k	UTSW	7	120858570	missense	probably benign
R7898:Eef2k	UTSW	7	120895218	missense	probably damaging	1.00
R8182:Eef2k	UTSW	7	120873403	missense	probably damaging	1.00
R8495:Eef2k	UTSW	7	120887880	missense	probably benign	0.00
R8807:Eef2k	UTSW	7	120891707	missense	possibly damaging	0.69
R8881:Eef2k	UTSW	7	120873325	missense	probably damaging	1.00
R8949:Eef2k	UTSW	7	120891988	missense	probably damaging	0.99
Z1177:Eef2k	UTSW	7	120858453	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGCTATCCCCAGAGACTTGG -3'
(R):5'- GTTATAATGTCTCGGCCAGCTG -3'

Sequencing Primer
(F):5'- GAAACCTCAGATGCTCTCTTGGATG -3'
(R):5'- GCCAGCTGCAAAGGCTATC -3'

Posted On

2020-07-28