Incidental Mutation 'R8288:Arpp19'
ID638531
Institutional Source Beutler Lab
Gene Symbol Arpp19
Ensembl Gene ENSMUSG00000007656
Gene NamecAMP-regulated phosphoprotein 19
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R8288 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location75037614-75060313 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 75037632 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000128921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007800] [ENSMUST00000164467] [ENSMUST00000167885] [ENSMUST00000168166] [ENSMUST00000168301] [ENSMUST00000169188] [ENSMUST00000169492] [ENSMUST00000170308]
Predicted Effect probably benign
Transcript: ENSMUST00000007800
SMART Domains Protein: ENSMUSP00000007800
Gene: ENSMUSG00000007656

DomainStartEndE-ValueType
Pfam:Endosulfine 7 104 4.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164467
SMART Domains Protein: ENSMUSP00000130730
Gene: ENSMUSG00000007656

DomainStartEndE-ValueType
Pfam:Endosulfine 7 104 4.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167885
SMART Domains Protein: ENSMUSP00000131597
Gene: ENSMUSG00000007656

DomainStartEndE-ValueType
Pfam:Endosulfine 3 88 5.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168166
SMART Domains Protein: ENSMUSP00000126618
Gene: ENSMUSG00000007656

DomainStartEndE-ValueType
Pfam:Endosulfine 7 104 4.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168301
Predicted Effect probably benign
Transcript: ENSMUST00000169188
SMART Domains Protein: ENSMUSP00000131922
Gene: ENSMUSG00000007656

DomainStartEndE-ValueType
Pfam:Endosulfine 10 65 7.4e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169492
AA Change: M1T
SMART Domains Protein: ENSMUSP00000128921
Gene: ENSMUSG00000007656
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 14 46 N/A INTRINSIC
Pfam:Endosulfine 54 142 1.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170308
SMART Domains Protein: ENSMUSP00000132350
Gene: ENSMUSG00000007656

DomainStartEndE-ValueType
Pfam:Endosulfine 7 104 4.5e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 19-kD cAMP-regulated phosphoprotein plays a role in regulating mitosis by inhibiting protein phosphatase-2A (PP2A; see MIM 176915) (summary by Gharbi-Ayachi et al., 2010 [PubMed 21164014]).[supplied by OMIM, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 C T 8: 22,793,137 A200T probably benign Het
Baiap2 T A 11: 119,997,639 V407E probably damaging Het
Cdh18 A G 15: 23,445,987 T508A probably damaging Het
Cnnm3 C A 1: 36,511,993 A28E possibly damaging Het
Cpb1 A T 3: 20,265,367 C184* probably null Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Disp2 T C 2: 118,790,281 V498A probably damaging Het
Dmgdh T C 13: 93,708,824 Y442H probably damaging Het
Eef2k T A 7: 120,903,381 M722K probably damaging Het
Erbb4 A G 1: 68,298,350 F603S probably damaging Het
Filip1l C T 16: 57,570,554 R502C probably damaging Het
Gbp9 C T 5: 105,105,733 V39M probably damaging Het
Gm17079 T C 14: 51,694,358 Y98C Het
Gstz1 A G 12: 87,147,830 M1V probably null Het
Hsd17b13 T G 5: 103,963,835 I281L probably benign Het
Hydin A G 8: 110,507,029 E1833G probably damaging Het
Irs1 G A 1: 82,287,961 Q845* probably null Het
Kctd11 C T 11: 69,880,057 G52R probably damaging Het
Kit T C 5: 75,654,489 S962P probably damaging Het
Lrrn1 C T 6: 107,566,994 probably benign Het
Mastl T C 2: 23,133,359 K451E probably damaging Het
Mptx2 A G 1: 173,274,789 V111A probably benign Het
Nuak2 G T 1: 132,327,841 C178F probably damaging Het
Pah G A 10: 87,538,185 R71H probably benign Het
Pclo C A 5: 14,712,871 T501K Het
Pla2g4e C T 2: 120,188,509 probably null Het
Polq A G 16: 37,027,910 E293G probably damaging Het
Rptor G A 11: 119,857,937 E782K probably benign Het
Scn7a T A 2: 66,675,974 R1524W probably damaging Het
Slc4a5 T C 6: 83,226,255 S46P probably benign Het
Srcap T A 7: 127,531,356 I664N probably damaging Het
Stk24 A C 14: 121,293,429 F372V possibly damaging Het
Szt2 T C 4: 118,389,776 S881G probably damaging Het
Trim40 T C 17: 36,883,318 D161G probably benign Het
Trip11 T C 12: 101,894,384 H234R possibly damaging Het
Trpc1 T C 9: 95,721,381 K366R probably damaging Het
Ugt2b35 T C 5: 87,001,457 L189P probably damaging Het
Unc80 A G 1: 66,473,350 S140G probably benign Het
Wdr60 A G 12: 116,213,725 F811S probably damaging Het
Zfp446 A G 7: 12,977,958 E36G probably benign Het
Zfp738 T A 13: 67,670,789 H361L possibly damaging Het
Other mutations in Arpp19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02047:Arpp19 APN 9 75056776 missense probably damaging 0.98
R0927:Arpp19 UTSW 9 75037685 utr 5 prime probably benign
R5636:Arpp19 UTSW 9 75037933 utr 5 prime probably benign
R6253:Arpp19 UTSW 9 75056734 missense probably damaging 1.00
R8897:Arpp19 UTSW 9 75056666 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TAGAACTCTCCGGAGCAGTG -3'
(R):5'- CCGGGAGAAGACAGATTACC -3'

Sequencing Primer
(F):5'- CTCCGGAGCAGTGGTAGCTTG -3'
(R):5'- TACCGCCGCCTTGTGAC -3'
Posted On2020-07-28