Incidental Mutation 'R8288:Dmgdh'
ID638541
Institutional Source Beutler Lab
Gene Symbol Dmgdh
Ensembl Gene ENSMUSG00000042102
Gene Namedimethylglycine dehydrogenase precursor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8288 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location93674433-93752833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93708824 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 442 (Y442H)
Ref Sequence ENSEMBL: ENSMUSP00000039663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048001]
Predicted Effect probably damaging
Transcript: ENSMUST00000048001
AA Change: Y442H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039663
Gene: ENSMUSG00000042102
AA Change: Y442H

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:DAO 44 407 9.3e-64 PFAM
Pfam:FAO_M 410 464 1e-15 PFAM
Pfam:GCV_T 468 738 3.6e-72 PFAM
Pfam:SoxG 559 697 1.3e-10 PFAM
Pfam:GCV_T_C 745 838 3.9e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme involved in the catabolism of choline, catalyzing the oxidative demethylation of dimethylglycine to form sarcosine. The enzyme is found as a monomer in the mitochondrial matrix, and uses flavin adenine dinucleotide and folate as cofactors. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 C T 8: 22,793,137 A200T probably benign Het
Arpp19 T C 9: 75,037,632 M1T probably null Het
Baiap2 T A 11: 119,997,639 V407E probably damaging Het
Cdh18 A G 15: 23,445,987 T508A probably damaging Het
Cnnm3 C A 1: 36,511,993 A28E possibly damaging Het
Cpb1 A T 3: 20,265,367 C184* probably null Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Disp2 T C 2: 118,790,281 V498A probably damaging Het
Eef2k T A 7: 120,903,381 M722K probably damaging Het
Erbb4 A G 1: 68,298,350 F603S probably damaging Het
Filip1l C T 16: 57,570,554 R502C probably damaging Het
Gbp9 C T 5: 105,105,733 V39M probably damaging Het
Gm17079 T C 14: 51,694,358 Y98C Het
Gstz1 A G 12: 87,147,830 M1V probably null Het
Hsd17b13 T G 5: 103,963,835 I281L probably benign Het
Hydin A G 8: 110,507,029 E1833G probably damaging Het
Irs1 G A 1: 82,287,961 Q845* probably null Het
Kctd11 C T 11: 69,880,057 G52R probably damaging Het
Kit T C 5: 75,654,489 S962P probably damaging Het
Lrrn1 C T 6: 107,566,994 probably benign Het
Mastl T C 2: 23,133,359 K451E probably damaging Het
Mptx2 A G 1: 173,274,789 V111A probably benign Het
Nuak2 G T 1: 132,327,841 C178F probably damaging Het
Pah G A 10: 87,538,185 R71H probably benign Het
Pclo C A 5: 14,712,871 T501K Het
Pla2g4e C T 2: 120,188,509 probably null Het
Polq A G 16: 37,027,910 E293G probably damaging Het
Rptor G A 11: 119,857,937 E782K probably benign Het
Scn7a T A 2: 66,675,974 R1524W probably damaging Het
Slc4a5 T C 6: 83,226,255 S46P probably benign Het
Srcap T A 7: 127,531,356 I664N probably damaging Het
Stk24 A C 14: 121,293,429 F372V possibly damaging Het
Szt2 T C 4: 118,389,776 S881G probably damaging Het
Trim40 T C 17: 36,883,318 D161G probably benign Het
Trip11 T C 12: 101,894,384 H234R possibly damaging Het
Trpc1 T C 9: 95,721,381 K366R probably damaging Het
Ugt2b35 T C 5: 87,001,457 L189P probably damaging Het
Unc80 A G 1: 66,473,350 S140G probably benign Het
Wdr60 A G 12: 116,213,725 F811S probably damaging Het
Zfp446 A G 7: 12,977,958 E36G probably benign Het
Zfp738 T A 13: 67,670,789 H361L possibly damaging Het
Other mutations in Dmgdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Dmgdh APN 13 93703778 splice site probably benign
IGL01406:Dmgdh APN 13 93687031 splice site probably benign
IGL01408:Dmgdh APN 13 93709295 missense probably damaging 1.00
IGL02167:Dmgdh APN 13 93720627 splice site probably benign
IGL02538:Dmgdh APN 13 93708753 missense possibly damaging 0.50
IGL02550:Dmgdh APN 13 93717575 missense probably damaging 1.00
IGL02563:Dmgdh APN 13 93674539 splice site probably benign
IGL02668:Dmgdh APN 13 93703910 missense probably damaging 1.00
IGL02889:Dmgdh APN 13 93715677 critical splice donor site probably null
IGL03293:Dmgdh APN 13 93706701 missense probably benign 0.11
R0646:Dmgdh UTSW 13 93752355 missense probably benign 0.04
R1531:Dmgdh UTSW 13 93744411 missense probably damaging 1.00
R1746:Dmgdh UTSW 13 93752425 missense probably benign
R1795:Dmgdh UTSW 13 93706699 missense probably benign
R1943:Dmgdh UTSW 13 93711370 missense probably benign 0.08
R1959:Dmgdh UTSW 13 93720559 missense probably benign 0.01
R3421:Dmgdh UTSW 13 93711361 missense probably benign 0.01
R3727:Dmgdh UTSW 13 93692067 missense probably damaging 1.00
R4523:Dmgdh UTSW 13 93688630 nonsense probably null
R5000:Dmgdh UTSW 13 93688538 missense probably damaging 1.00
R5589:Dmgdh UTSW 13 93677157 missense probably damaging 1.00
R5913:Dmgdh UTSW 13 93752323 missense possibly damaging 0.92
R6056:Dmgdh UTSW 13 93708743 missense possibly damaging 0.67
R6056:Dmgdh UTSW 13 93752326 missense probably damaging 1.00
R6057:Dmgdh UTSW 13 93752452 missense probably benign 0.00
R6180:Dmgdh UTSW 13 93752286 missense possibly damaging 0.61
R6259:Dmgdh UTSW 13 93752308 missense probably benign 0.01
R6608:Dmgdh UTSW 13 93706744 missense possibly damaging 0.81
R6636:Dmgdh UTSW 13 93709198 missense probably benign 0.08
R6637:Dmgdh UTSW 13 93709198 missense probably benign 0.08
R6739:Dmgdh UTSW 13 93720615 missense probably benign 0.07
R7157:Dmgdh UTSW 13 93715535 missense probably damaging 1.00
R7200:Dmgdh UTSW 13 93691885 missense probably damaging 1.00
R7312:Dmgdh UTSW 13 93708846 splice site probably null
R7349:Dmgdh UTSW 13 93752233 missense possibly damaging 0.80
R8087:Dmgdh UTSW 13 93703871 missense possibly damaging 0.95
R8290:Dmgdh UTSW 13 93706736 missense probably benign 0.05
R8371:Dmgdh UTSW 13 93708730 missense probably benign 0.00
R8469:Dmgdh UTSW 13 93706667 missense probably damaging 1.00
R8768:Dmgdh UTSW 13 93688610 missense possibly damaging 0.52
X0066:Dmgdh UTSW 13 93752374 missense possibly damaging 0.90
Z1177:Dmgdh UTSW 13 93677183 missense probably damaging 0.96
Z1177:Dmgdh UTSW 13 93709288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGACGTGTTTCACCACTTG -3'
(R):5'- GTGATGGACCCAATACGTTAAAC -3'

Sequencing Primer
(F):5'- GACGTGTTTCACCACTTGAATGC -3'
(R):5'- GGACCCAATACGTTAAACATATACAG -3'
Posted On2020-07-28