Incidental Mutation 'R8288:Cdh18'
ID638544
Institutional Source Beutler Lab
Gene Symbol Cdh18
Ensembl Gene ENSMUSG00000040420
Gene Namecadherin 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R8288 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location22549022-23474418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23445987 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 508 (T508A)
Ref Sequence ENSEMBL: ENSMUSP00000130851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164787] [ENSMUST00000165614] [ENSMUST00000167623]
Predicted Effect probably damaging
Transcript: ENSMUST00000164787
AA Change: T508A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130851
Gene: ENSMUSG00000040420
AA Change: T508A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
CA 509 596 3.7e-5 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 6.8e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165614
AA Change: T508A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128643
Gene: ENSMUSG00000040420
AA Change: T508A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167623
SMART Domains Protein: ENSMUSP00000128011
Gene: ENSMUSG00000040420

DomainStartEndE-ValueType
CA 22 103 4.24e-14 SMART
CA 127 212 1.37e-31 SMART
CA 236 328 2.76e-13 SMART
CA 351 414 4.15e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is expressed specifically in the central nervous system and is putatively involved in synaptic adhesion, axon outgrowth and guidance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 C T 8: 22,793,137 A200T probably benign Het
Arpp19 T C 9: 75,037,632 M1T probably null Het
Baiap2 T A 11: 119,997,639 V407E probably damaging Het
Cnnm3 C A 1: 36,511,993 A28E possibly damaging Het
Cpb1 A T 3: 20,265,367 C184* probably null Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Disp2 T C 2: 118,790,281 V498A probably damaging Het
Dmgdh T C 13: 93,708,824 Y442H probably damaging Het
Eef2k T A 7: 120,903,381 M722K probably damaging Het
Erbb4 A G 1: 68,298,350 F603S probably damaging Het
Filip1l C T 16: 57,570,554 R502C probably damaging Het
Gbp9 C T 5: 105,105,733 V39M probably damaging Het
Gm17079 T C 14: 51,694,358 Y98C Het
Gstz1 A G 12: 87,147,830 M1V probably null Het
Hsd17b13 T G 5: 103,963,835 I281L probably benign Het
Hydin A G 8: 110,507,029 E1833G probably damaging Het
Irs1 G A 1: 82,287,961 Q845* probably null Het
Kctd11 C T 11: 69,880,057 G52R probably damaging Het
Kit T C 5: 75,654,489 S962P probably damaging Het
Lrrn1 C T 6: 107,566,994 probably benign Het
Mastl T C 2: 23,133,359 K451E probably damaging Het
Mptx2 A G 1: 173,274,789 V111A probably benign Het
Nuak2 G T 1: 132,327,841 C178F probably damaging Het
Pah G A 10: 87,538,185 R71H probably benign Het
Pclo C A 5: 14,712,871 T501K Het
Pla2g4e C T 2: 120,188,509 probably null Het
Polq A G 16: 37,027,910 E293G probably damaging Het
Rptor G A 11: 119,857,937 E782K probably benign Het
Scn7a T A 2: 66,675,974 R1524W probably damaging Het
Slc4a5 T C 6: 83,226,255 S46P probably benign Het
Srcap T A 7: 127,531,356 I664N probably damaging Het
Stk24 A C 14: 121,293,429 F372V possibly damaging Het
Szt2 T C 4: 118,389,776 S881G probably damaging Het
Trim40 T C 17: 36,883,318 D161G probably benign Het
Trip11 T C 12: 101,894,384 H234R possibly damaging Het
Trpc1 T C 9: 95,721,381 K366R probably damaging Het
Ugt2b35 T C 5: 87,001,457 L189P probably damaging Het
Unc80 A G 1: 66,473,350 S140G probably benign Het
Wdr60 A G 12: 116,213,725 F811S probably damaging Het
Zfp446 A G 7: 12,977,958 E36G probably benign Het
Zfp738 T A 13: 67,670,789 H361L possibly damaging Het
Other mutations in Cdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Cdh18 APN 15 23173796 missense probably damaging 0.97
IGL01663:Cdh18 APN 15 23445991 missense possibly damaging 0.92
IGL01758:Cdh18 APN 15 23474183 missense probably benign 0.20
IGL02192:Cdh18 APN 15 23460316 missense probably damaging 1.00
IGL02448:Cdh18 APN 15 23173789 missense probably benign 0.00
IGL02717:Cdh18 APN 15 23410715 nonsense probably null
IGL03241:Cdh18 APN 15 23226933 missense probably benign 0.19
IGL03268:Cdh18 APN 15 23366867 missense probably damaging 1.00
IGL03307:Cdh18 APN 15 23226786 missense probably damaging 1.00
R0316:Cdh18 UTSW 15 23366913 missense probably damaging 1.00
R0462:Cdh18 UTSW 15 23366885 missense probably damaging 1.00
R0607:Cdh18 UTSW 15 23410790 missense probably benign 0.01
R0761:Cdh18 UTSW 15 23226752 missense possibly damaging 0.87
R0973:Cdh18 UTSW 15 23473995 missense probably damaging 0.99
R1110:Cdh18 UTSW 15 23474317 missense probably benign 0.00
R1550:Cdh18 UTSW 15 23436548 missense probably damaging 1.00
R1656:Cdh18 UTSW 15 23474399 missense probably benign 0.38
R1682:Cdh18 UTSW 15 23400585 missense probably benign 0.05
R1770:Cdh18 UTSW 15 23474401 missense probably benign
R1829:Cdh18 UTSW 15 23173852 missense probably damaging 1.00
R2253:Cdh18 UTSW 15 23410805 missense probably benign 0.00
R2435:Cdh18 UTSW 15 23367008 missense probably damaging 1.00
R3914:Cdh18 UTSW 15 23410685 missense probably damaging 1.00
R3964:Cdh18 UTSW 15 23474101 missense probably benign
R4002:Cdh18 UTSW 15 23382962 missense possibly damaging 0.48
R4291:Cdh18 UTSW 15 22714551 intron probably benign
R4581:Cdh18 UTSW 15 23226783 missense probably damaging 1.00
R4604:Cdh18 UTSW 15 23474368 missense probably benign 0.05
R4625:Cdh18 UTSW 15 22714042 intron probably benign
R4786:Cdh18 UTSW 15 23410787 missense probably null 1.00
R4811:Cdh18 UTSW 15 23226791 missense probably benign 0.30
R5023:Cdh18 UTSW 15 23259666 missense probably damaging 1.00
R5094:Cdh18 UTSW 15 22714539 intron probably benign
R5278:Cdh18 UTSW 15 23474158 missense probably benign 0.04
R5416:Cdh18 UTSW 15 23226723 missense probably damaging 1.00
R5503:Cdh18 UTSW 15 23436534 missense probably damaging 0.96
R5617:Cdh18 UTSW 15 23226768 missense probably damaging 0.97
R5982:Cdh18 UTSW 15 23474216 missense possibly damaging 0.89
R6240:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6475:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6649:Cdh18 UTSW 15 23436534 missense possibly damaging 0.87
R6700:Cdh18 UTSW 15 23474105 missense probably benign
R6718:Cdh18 UTSW 15 23226749 missense probably benign 0.15
R6796:Cdh18 UTSW 15 23446073 missense probably damaging 1.00
R7330:Cdh18 UTSW 15 23226950 missense possibly damaging 0.46
R7429:Cdh18 UTSW 15 23366856 missense possibly damaging 0.89
R7477:Cdh18 UTSW 15 23410725 missense probably benign
R7516:Cdh18 UTSW 15 23259598 splice site probably null
R7519:Cdh18 UTSW 15 23474212 missense possibly damaging 0.68
R7575:Cdh18 UTSW 15 23400597 nonsense probably null
R7618:Cdh18 UTSW 15 23366970 missense probably damaging 1.00
R7844:Cdh18 UTSW 15 23410787 missense probably damaging 1.00
R7870:Cdh18 UTSW 15 23474327 missense possibly damaging 0.94
R8420:Cdh18 UTSW 15 23474052 missense possibly damaging 0.94
R8430:Cdh18 UTSW 15 23226684 missense probably damaging 1.00
Z1189:Cdh18 UTSW 15 23474283 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GTACCATGATGTAATAAAGCGTGGG -3'
(R):5'- CGTGTGTAGAGGACTGAAGC -3'

Sequencing Primer
(F):5'- TGTCTTTTCCTAAAACCAATTGGAG -3'
(R):5'- GGACTGAAGCAAAACTAATCATGTC -3'
Posted On2020-07-28